Ақпарат

16.12: Клондау – Биология


Молекулярлық клондау

Жалпы алғанда, «клондау» сөзі мінсіз көшірме жасауды білдіреді; дегенмен, биологияда тұтас организмнің қайта құрылуы «көбеюді клондау» деп аталады. Бүкіл ағзаны клондау әрекеттері жасалғанға дейін зерттеушілер геномның қажетті аймақтарын немесе фрагменттерін көбейтуді үйренді, бұл процесс молекулалық клондау деп аталады.

Геномның кішігірім фрагменттерін клондау нақты гендерді (және олардың ақуыздық өнімдерін) немесе кодталмаған аймақтарды оқшаулап өңдеуге және зерттеуге мүмкіндік береді. Плазмида (вектор деп те аталады) микроорганизмдердің хромосомалық ДНҚ-сынан тәуелсіз репликацияланатын шағын дөңгелек ДНҚ молекуласы. E. coli. Клондау кезінде плазмидті молекулалар қажетті ДНҚ фрагментін енгізу үшін «қалта» қамтамасыз ету үшін пайдаланылуы мүмкін. Плазмидалар әдетте көбею үшін бактерия иесіне енгізіледі. Бактериялық контексте адам геномының ДНҚ фрагменті (немесе зерттелетін басқа организмнің геномы) деп аталады. бөгде ДНҚ, немесе трансген, оны бактерияның ДНҚ-сынан ажырату үшін, ол деп аталады. хост ДНҚ.

Плазмидалар табиғи түрде бактериялар популяциясында кездеседі (мысалы, ішек таяқшасы) және организмге қолайлы белгілерді қоса алатын гендер бар, мысалы антибиотиктерге төзімділік (антибиотиктер әсер етпеу қабілеті). Плазмидалар молекулалық клондауға және инсулин мен адамның өсу гормоны сияқты маңызды реагенттерді ауқымды өндіруге арналған векторлар ретінде қайта тағайындалды және құрастырылды. Плазмидтік векторлардың маңызды ерекшелігі - бөгде ДНҚ фрагментін енгізудің қарапайымдылығы. бірнеше клондау сайты (MCS). MCS - бұл әртүрлі жалпы қол жетімді шектеу эндонуклеазаларымен кесуге болатын бірнеше учаскелерді қамтитын қысқа ДНҚ тізбегі. Рестрикциялық эндонуклеазалар нақты ДНҚ тізбектерін тану және оларды болжамды түрде кесу; олар табиғи түрде бөгде ДНҚ-ға қарсы қорғаныс механизмі ретінде бактериялар арқылы өндіріледі. Көптеген рестрикциялық эндонуклеазалар ДНҚ-ның екі тізбегінде сатылы кесулер жасайды, осылайша кесілген ұштарында 2 немесе 4 негізді бір тізбекті саңылау болады. Бұл асып кетулер қосымша үстемелермен жасытуға қабілетті болғандықтан, олар «жабысқақ ұштар» деп аталады. ДНҚ лигаза деп аталатын ферменттің қосылуы фосфодиэфирлік байланыстар арқылы ДНҚ фрагменттерін тұрақты түрде біріктіреді. Осылайша, рестрикциялық эндонуклеаза ыдырауы нәтижесінде пайда болған кез келген ДНҚ фрагменті бірдей рестрикциялық эндонуклеазамен кесілген плазмидтік ДНҚ-ның екі ұшы арасында біріктірілуі мүмкін (1-сурет).

Рекомбинантты ДНҚ молекулалары

Ішіне бөгде ДНҚ енгізілген плазмидалар деп аталады рекомбинантты ДНҚ молекулалар, өйткені олар жасанды түрде жасалған және табиғатта кездеспейді. Оларды химерлі молекулалар деп те атайды, өйткені молекулалардың әртүрлі бөліктерінің шығу тегі әр түрлі биологиялық организмдерге немесе тіпті химиялық синтезге байланысты болуы мүмкін. Рекомбинантты ДНҚ молекулаларынан экспрессияланатын белоктар деп аталады рекомбинантты ақуыздар. Барлық рекомбинантты плазмидалар гендерді экспрессиялауға қабілетті емес. Рекомбинантты ДНҚ-ны ген экспрессиясы үшін жақсырақ жасалған басқа векторға (немесе хостқа) жылжыту қажет болуы мүмкін. Ғалымдар рекомбинантты ақуыздардың экспрессиясын бақылай алатындай, белгілі бір қоршаған орта факторларымен ынталандырылған кезде ғана плазмидалар ақуыздарды экспрессиялау үшін жасалуы мүмкін.

ДНҚ оқу орталығынан клондаудағы рекомбинация анимациясын қараңыз.

Жасушалық клондау

Бактериялар мен ашытқылар сияқты біржасушалы организмдер екілік бөліну арқылы жыныссыз жолмен көбейген кезде табиғи түрде өздерінің клондарын жасайды; бұл ретінде белгілі жасушалық клондау. Ядролық ДНҚ митоз процесі арқылы қайталанады, бұл генетикалық материалдың дәл көшірмесін жасайды.

Практикалық сұрақ

Сіз молекулярлық биология зертханасында жұмыс істеп жатырсыз және сіздің зертханалық серіктесіңіз сіз білместен, сіз клондауды жоспарлап отырған шетелдік геномдық ДНҚ-ны мұздатқышта сақтаудың орнына түні бойы зертханалық үстелде қалдырды. Нәтижесінде ол нуклеазалардың әсерінен бұзылды, бірақ әлі де тәжірибеде қолданылды. Плазмида, керісінше, жақсы. Молекулярлық клондау тәжірибесінен қандай нәтиже күтер едіңіз?

  1. Бактерия пластинасында колониялар болмайды.
  2. Тек көк колониялар болады.
  3. Көк және ақ колониялар болады.
  4. Тек ақ колониялар болады.

[ашу-жауап q=”511969″]Жауапты көрсету[/reveal-answer]
[жасырын-жауап a=”511969″]Жауап b. Тәжірибе нәтижесінде тек көк колониялар пайда болады.[/hidden-answer]

Репродуктивті клондау

Репродуктивті клондау бүкіл көп жасушалы организмнің клонын немесе бірдей көшірмесін жасау үшін қолданылатын әдіс. Көп жасушалы организмдердің көпшілігі жыныстық жолмен көбеюден өтеді, бұл екі дараның (ата-ананың) генетикалық будандастыруын қамтиды, бұл ата-аналардың кез келгенінің бірдей көшірмесін немесе клонын генерациялауды мүмкін емес етеді. Биотехнологияның соңғы жетістіктері зертханада сүтқоректілердің жыныссыз көбеюін жасанды түрде индукциялауға мүмкіндік берді.

Партеногенез немесе «қыз туу» ұрық жұмыртқаны ұрықтандырусыз өсіп, дамитын кезде орын алады; бұл жыныссыз көбеюдің бір түрі. Партеногенездің мысалы аналық жұмыртқа салатын және егер жұмыртқа ұрықтанса, ол диплоидты жұмыртқа болып табылатын және жеке адам аналыққа айналатын түрлерде кездеседі; егер жұмыртқа ұрықтанбаса, ол гаплоидты жұмыртқа болып қалады және аталыққа айналады. Ұрықтанбаған жұмыртқаны партеногенді немесе тың жұмыртқа деп атайды. Кейбір жәндіктер мен бауырымен жорғалаушылар ересектерге айналуы мүмкін партеногенді жұмыртқа салады.

Жыныстық көбею үшін екі жасуша қажет; гаплоидты жұмыртқа мен сперматозоидтар біріктірілгенде, диплоидты зигота пайда болады. Зигота ядросында жаңа жеке адамды тудыру үшін генетикалық ақпарат бар. Дегенмен, ерте эмбриональды даму үшін жұмыртқа жасушасындағы цитоплазмалық материал қажет. Бұл идея репродуктивті клондаудың негізін құрайды. Демек, егер жұмыртқа жасушасының гаплоидты ядросы бір түрдің кез келген дарасының (донор деп аталады) жасушасынан диплоидты ядромен ауыстырылса, ол донорға генетикалық жағынан ұқсас зиготаға айналады. Соматикалық жасушаның ядролық тасымалдануы - диплоидты ядроны энуклеацияланған жұмыртқаға көшіру әдісі. Оны терапевтік клондау немесе репродуктивті клондау үшін пайдалануға болады.

Бірінші клондалған жануар 1996 жылы туған Долли қойы болды. Ол кезде репродуктивті клондаудың сәттілігі өте төмен болды. Долли жеті жыл өмір сүріп, тыныс алу жолдарының асқынуынан қайтыс болды (2-сурет). Жасушаның ДНҚ-сы егде адамға тиесілі болғандықтан, ДНҚ жасы клондалған адамның өмір сүру ұзақтығына әсер етуі мүмкін деген болжам бар. Доллиден бері жылқылар, бұқалар және ешкілер сияқты бірнеше жануарлар сәтті клондалды, бірақ бұл адамдар жиі бет, аяқ-қол және жүрек ақауларын көрсетеді. Эмбрионалды дің жасушаларының көзі ретінде клондалған адам эмбриондарын шығару әрекеттері болды, кейде терапиялық мақсаттар үшін клондау деп аталады. Терапевтік клондау зиянды ауруларды немесе ақауларды жоюға әрекет жасау үшін дің жасушаларын шығарады (ағзаны көбейтуді мақсат ететін репродуктивті клондаудан айырмашылығы). Дегенмен, терапевтік клондау әрекеттері биоэтикалық ойларға байланысты қарсылыққа тап болды.

Практикалық сұрақ

Қалай ойлайсыз, Долли Финн-Дорсет немесе Шотландияның Blackface қойы болды ма?

[практика-аймақ жолдары=”2″][/практика-аймақ]
[ашу-жауап q=”985505″]Жауапты көрсету[/reveal-answer]
[hidden-answer a=”985505″]Долли Фин-Дорсет қойы болды, өйткені бастапқы жасуша шотландиялық қара бетті қойдан, ал суррогат ана шотландиялық қара бетті қойдан шыққанымен, ДНҚ Фин-Дорсет қойынан шыққан.[/hidden -жауап]


Қымбат емес кірістерден каннабиноидтарды өндіруге арналған био-шабытталған жасушасыз жүйе

Каннабиноидтар өндірісін өсімдік экстракциясының ыңғайсыздығынан және инженерлік микробтарға көшіру осы маңызды емдік молекулалардың дәйекті, таза, арзан және қоршаған ортаға зиянсыз көзін қамтамасыз ете алады, бірақ микробтық өндіріс айтарлықтай қиындықтарға тап болады. Микробтар мен өсімдіктерге балама ферменттік биосинтезді қолдану арқылы жасушалық жүйелердің күрделілігін жою болып табылады. Мұнда біз келесі мүмкіндіктері бар каннабиноидтарды өндіруге арналған жаңа жасушасыз жүйені жобалап, енгіземіз: (1) тек арзан кірістер қажет (2) тек 12 фермент жұмыс істейді (3) жүйе оттегін қажет етпейді және (4) біз поликетид биосинтезі сияқты малонил-КоА-тәуелді жолдарға әдетте қолданылатын ATP талаптарын азайту үшін табиғи емес ферменттер жүйесін қолданамыз. Жүйе шығарады

0,5 г л −1 каннабигерол қышқылы (CBGA) немесе каннабигероварин қышқылы (CBGVA) арзан өнімдерден, ашытқы негізіндегі өндірістен шамамен екі рет жоғары. Бұл сияқты ұяшықсыз жүйелер каннабиноидтарды сенімді өндіруге жаңа жолды қамтамасыз етуі мүмкін.


МАТЕРИАЛДАР МЕН ТӘСІЛДЕР

Жаңа рецепторлық геномдық ДНҚ-ны бастапқы оқшаулау үшін ПТР күшейту. Алға праймер (OPS3: CATAGCCCTCGACCGGTACT) үшінші трансмембраналық доменнің цитоплазмалық ұшын кодтайды.Дрозофила октопамин/тирамин рецепторы (OctyR99AB) (Arakawa және т.б., 1990). Кері праймер (OPS4: GGCAGCCAGCAGATGACGAA) осы рецептордан VI трансмембраналық доменнің ортаңғы аймағын кодтайды. ПТР үлгісі 300 нг болды Дрозофила жабайы типті Canton-S ересек шыбындарынан дайындалған геномдық ДНҚ (Джоветт, 1986). 100 мкл ПТР қоспасының әрқайсысында 0,2 м м дезоксирибонуклеотидтрифосфат, 10 м м Tris-HCl буфері, рН 8,3, 50 м м KCl, 1,5 м м MgCl болды.2, 0,001% желатин, әрбір праймерден 0,1 μ м және AmpliTaq ДНҚ полимеразасының 2,5 бірлігі (Перкин-Элмер, Норвалк, CT). ПТР төмендетілген қатаң жасыту жағдайында орындалды: 2 минут бойы 94°C, 2 минут бойы 33°C, 6 цикл үшін 2 минут бойы 72°C, содан кейін жасыту температурасы 33° орнына 42°C болатын қосымша 31 цикл. C. Соңғы ұзарту 72°C температурада 10 минутты құрады. ПТР өнімдері 1% агарозды гельде 10 мкл реакциялық қоспаның электрофорезі арқылы талданды.

ДНҚ секвенциясы. ПТР өнімінің тікелей реттілігі бұрын сипатталғандай орындалды (Фэн және т.б., 1995 Zheng және т.б., 1995). Так Dye Primer Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). cDNA клонының секвенирленуін жеңілдету үшін кірістірілген жоюлар қолданылды (Хеникофф, 1987). ДНҚ-ның әрбір сегменті екі бағытта кемінде екі рет реттелген. Контиг Geneworks бағдарламалық құралының көмегімен құрастырылды (Intelligenetics, Mountain View, CA).

cDNA клондарына скрининг. Бастапқы ПТР күшейту тәжірибесінің 0,68 кб фрагменті Multiprime ДНҚ таңбалау жүйесін (Amersham, Arlington Heights, IL) пайдаланып [α- 32 P]dCTP (~110 ТБк/ммоль) белгісімен белгіленді және скрининг үшін пайдаланылды. Дрозофила бас cDNA кітапханасы (Itoh және т.б., 1985) λgt11, жомарт доктор Пол Салватерра (Бекман зерттеу институты, Дуарте, Калифорния). Төрт оң клон 4 × 10 5 бляшка түзетін бірліктерді (pfu) жоғары қатаңдықпен (Sambrook et al., 1989) скрининг арқылы анықталды. Ең ұзын кірістіру (4 кб) көмегімен кесілген ЭкоRI және одан әрі талдау үшін pBluescript II SK(−) ішіне қосалқы клондалған. Бұл кірістіру және оны кодтайтын ген осы қағазда DopR99B деп аталады.

Солтүстік дақтар. Бастар, денелер және қосымшалар (аяқтар мен антенналар) мұздатылған ересек шыбындардан оқшауланған (Шмидт-Нилсен және т.б., 1977). Поли(А) + РНҚ және дақтар бұрын сипатталғандай дайындалды (Фэн және басқалар, 1995 Zheng және т.б., 1995). Поли(А) + РНҚ (10 мкг/жолақ) денатурацияланатын формальдегидті агароза (0,8%) гельде жүргізілді. Блоттар 10 6 cpm/ml соңғы концентрацияға қосылған 32 P-таңбаланған 0,68 кб ПТР фрагменті арқылы зерттелді. Жоғары қатаң жуудан кейін (Feng және т.б., 1995 Zheng және т.б., 1995) дақтар -70 ° C температурада 24 сағат бойы рентгендік пленкаға ұшырады.

Орнында сілекей бездерінің хромосомаларының сквоштарына будандастыру.0,68 кб ПТР фрагменті биотинилденді, личинка сілекей безінің политенді хромосома сквоштарына гибридтелді және Энгельс және т.б. сипаттағандай Gibco (Gaithersburg, MD) Bluegene анықтау жинағы арқылы локализацияланды. (1985) кішігірім модификациялармен (Feng және т.б., 1995 Zheng et al., 1995).

өрнек Ксенопус ооциттер. Сезім кРНҚ дайындалды in vitro pBluescript II SK(−) векторындағы DopR99B клонынан T7 РНҚ полимеразасын (Stratagene, La Jolla, CA) пайдаланып, плазмидті сызықты ЖоқМен (Promega, Madison, WI). Транскрипттер стандартты 150 мкл транскрипция реакциясына (Stratagene жинағы) 0,75 бірлік m 7 G(5′)ppp(5′)G (Boehringer Mannheim, Indianapolis, IN) қосу арқылы жабылды.

V және VI сатыдағы овциттер, тың әйел ересек Xenopus laevis қолмен бөлініп, стерильді ND96 ортасына орналастырылды [м м : NaCl 96, KCl 2, CaCl2 1,8, MgCl2 1, HEPES буфері (рН 7,6) 5, құрамында 2,4 м м натрий пируваты, 100 У/мл пенициллин, 0,1 мг/мл стрептомицин, 0,2 мг/мл гентамицин]. Ооциттер құрамында коллагеназа (2 мг/мл) бар ND96-да 30 минут бойы инкубациялау арқылы ферментативті түрде дефолликуляцияланды. Ооциттерге 50 нг инъекция жасалды Дрозофила DopR99B рецепторы кРНҚ-ны сезеді және 19°C температурада 2–5 күн бойы инкубациялады. Бақылау ретінде енгізілмеген ооциттер пайдаланылды.

Электрофизиологиялық жазбалар ооцит токтарын өлшеу үшін −60 мВ ұстап тұру потенциалында екі микроэлектродты кернеу қысқышы әдісін қолданып ооциттерден жасалды (Ван Рентергем және т.б., 1987). Бөлме температурасында эксперименттер кезінде ооциттер үздіксіз ND96 қоспасымен толықтырылды және суперфузатқа препараттар қосылды.

cAMP талдаулары. cAMP деңгейін бақылау үшін жеке ооциттер 30 минут бойы ND96 плюс 100 мкм изобутилметилксантинде (IBMX) алдын ала инкубацияланды. Эксперименттік ооциттер бір ортада агонисттің қажетті концентрациясымен тағы 30 минут инкубацияланды, ал бақылау ооциттер (базальды cAMP деңгейін өлшеу үшін) агонистсіз бір ортада параллель инкубацияланды. Инкубациялардан кейін әрбір ооцит 500 мкл қышқылдандырылған этанолда гомогенизацияланды, бөлшектерді кетіру үшін центрифугадан өтті және үстіңгі зат вакуумдық центрифугада (Савант, Фармингдейл, Нью-Йорк) кепкенге дейін буланды. Әрбір үлгі 60 мкл талдау буферіне алынды және коммерциялық талдау жинағы (Amersham) арқылы cAMP үшін талдау жасалды.

Есірткілер. Көрсетілген рецепторлардың жіктелуінде қолданылатын препараттар келесі көздерден алынды: дофамин гидрохлориді, (−)-норепинефрин гидрохлориді, (−)-эпинефрин, тирамин гидрохлориді, dl-октопамин гидрохлориді, 5-гидрокситриптамин гидрохлориді, (±)- изопротеренол гидрохлориді, фентоламин гидрохлориді және dl-пропранолол Сигмадан алынған (Пул, Дорсет, Ұлыбритания) Р(+)-SKF-38393 [Р(+)-1-фенил-2,3,4,5-тетрагидро-(1Н)-3-бензазепин-7,8-диол], хинелорандигидрохлорид, (−)-хинпирол гидрохлориді, PD-128,907 [(+)- (4aR,10bR)-3,4,4a,10b-тетрагидро4-пропил-2Н,5Н-(1)бензопирано-(4,3-б)-1,4-оксазин-9-ол-гидрохлорид],cis-(Z)-флупентиксол дигидрохлориді,Р(+)SCH-23390 [Р(+)-7хлоро-8-гидрокси-3-метил-1-фенил-2,3,4,5-тетрагидро-1Н-3-бензепин гидрохлориді], S(−)-сульпирид, спиперон гидрохлориді, (+)- бутакламол гидрохлориді, S(−)-этиклоприд гидрохлориді, домперидон, (+)-бромокриптин метансульфонат, (±)-6-хлор-АПВ [(±)-6-хлор-7,8-дигидрокси-3-аллил-1- фенил-2,3,4,5-тетрагидро-1Н-3бензазепин гидробромиді], Р(+)-6-бром-APB (Р(+)-6-бромо7, 8-дигидрокси-3-аллил-1-фенил-2,3,4,5-тетрагидро-1Н-3-бензазепин гидробромиді), (±)-6-хлоро-PB [ (±)-6-хлоро-7,8-дигидрокси-1-фенил-2,3,4,5-тетрагидро-1Н-3-бензазепин гидробромиді], және (±)-PPHT [(±)-2-(Н-фенилэтил-Н-пропил)амино-5-гидрокситетралин гидрохлориді] Research Biochemicals (Natick, MA) компаниясынан алынды.


2 Жауап 2

Мен жоғары сапалы антиденелер шығаратын жетекші компанияда ұзақ уақыт жұмыс істедім, сондықтан мен өз тәжірибемді сіздермен бөлісуге тырысамын. Жоғары спецификалық антиденелерді жасау процесі (мен моноклоналдарға тоқталатын боламын) үш маңызды бөліктен тұрады - антигенді жобалау және иммундау, клондау және субклондау және скрининг/валидация. Әрбір бөлік өз бетінше шешуші болып табылады және неғұрлым жақсы орындалса, төменгі ағында табысқа жету мүмкіндігіңіз соғұрлым жоғары болады.

Антидене жұмыс істеуі үшін ол мақсатқа арнайы байланысуы керек. Мен мұнда барлық ерекшеліктерге тоқталмаймын, өйткені антиген дизайны бойынша жақсы ашық әдебиеттер бар, бірақ негізінен сізге хосттың күшті иммундық реакциясын дамытатын, таңдауға болатын әртүрлі клондарды беретін нәрсе керек және спецификалық - ол сізді қызықтыратын ақуыздан басқа басқа мақсаттарды байланыстырмауы керек. Антигенділік, ерігіштік, өндірістің қарапайымдылығы (иммунизациялау және скрининг үшін), стерикалық ойлар (басқа ақуыз немесе нуклеин қышқылы мақсатты аймақты жасырады ма) сияқты көптеген факторларды ескеру қажет. in vivo?), және басқалар. Антигендер шамамен екі түрге бөлінеді - пептидтер (әдетте 20 немесе 30 аминқышқылдарынан аз) және ақуыздар немесе ақуыз фрагменттері. Табысқа жету ықтималдығын арттыру үшін сіз бірнеше антигендерді қолданғыңыз келуі мүмкін. Антиген синтезделгеннен және тазартылғаннан кейін жануар(ларды) дайындау және күшейту үшін иммундау кестесін жасау керек, содан кейін оларды қашан және қалай сынау (скрининг) және оны қай уақытта және қалай жинау керектігін анықтау керек. моноклональды процесс.

Содан кейін клондау процесі басталады. Клондарды әртүрлі әдістермен жасауға болады, олардың кейбіреулері әртүрлі гибридома әдістері сияқты кеңінен қол жетімді, ал кейбіреулері жеке компанияларға тиесілі. Менің бұрынғы компаниям жануарлардың түріне байланысты екеуінің де қоспасын пайдаланды, ол үнемі жетілдірілген және кеңейтіліп отыратын шынымен керемет үйдегі технологияны қолданды. Бұл процестер пайдаланылатын материалдардың сапасына және клондаушылардың тәжірибесіне өте тәуелді. Кіріс В жасушалары (антиденелерді жасайтын) өміршең клондардың ең көп санын қамтамасыз ету үшін нақты қадамдар жиынтығына сәйкес жиналуы, өңделуі және сақталуы керек. Өлмейтін жасушалар алынғаннан кейін (мысалы, гибридома процесінде миелома серіктес жасушаларымен біріктірілгеннен кейін) олар алдын ала анықталған жасушалар санына дейін сұйылтылады және 96 шұңқырлы пластинкаларға салынады және біраз уақытқа қалпына келтіріліп, өседі, оның барысында олар ортаға антиденелерді бөледі. Содан кейін бұл медиа тез сыналады (клеткалар ұңғымадан асып кетпес бұрын) және оң ұңғымалар бір жасушалы суспензияға (үміттенеміз) сұйылтылады және субклондалады немесе кейінірек мұздатады. Бірінші тестілеу жиі иммунизациялаушы антигенді пайдалана отырып, ELISA әдісімен жүргізіледі, дегенмен қызығушылықты қолдануыңызға байланысты ол ағынды цитометрия, иммуногистохимия немесе иммунофлуоресценция арқылы жоғары өнімді скрининг арқылы болуы мүмкін. Бастапқы сынақтан кейін қосалқы клондау және қайта сынаудың келесі қадамдары өлшенген қарқынмен өтуі мүмкін, өйткені үстіңгі қабатта антиденелердің жеткілікті мөлшерін тудырғаннан кейін жасушалар шексіз мұздатылуы мүмкін.

Бұл жерде сіздің скринингтік бағдарламаңыздың сапасы басталады. Сіздің талдауларыңыз жақсы жобаланған, сенімді, жақсы құжатталған және орындалуы керек, сондай-ақ белгілі бір клонның қызығушылық тудыратынын нақты анықтай алатындай оң және теріс бақылаулар болуы керек. немесе бар өнімнен жақсырақ жұмыс істейді. Бұл бақыланатын шарттарды, стандартталған реагенттер мен хаттамаларды және талдаудан талдауға дейін қайталанудың жоғары дәрежесін білдіреді. Сондай-ақ, басқару элементтерінің орындылығын жеткілікті түрде атап көрсету мүмкін емес. Салыстыру үшін сізде нокаут немесе экспрессивті емес үлгі немесе индукцияланған немесе тежелген белсенділікке қарсы бастапқы мәнді қарау тәсілі бар ма? ChIP үшін, егер сізді қызықтыратын геніңіз үшін жақсы бақылаушы антидене мен праймер жұбы болмаса, талдаудың жұмыс істейтінін қалай білуге ​​болады? Тікелей иммунопреципитация-Вестерн блотын жасау арқылы керемет нәтижеге қол жеткізуіңіз мүмкін, бірақ ДНҚ-байланысты протеинді әлі де түсіре алмайсыз. Егер сіздің ChIP әдісіңіз таза ДНҚ жасамаса, сіз ешқашан байланыстыра алмайсыз. Егер сізде бірнеше қайталанатын ұңғымалармен сәйкес деректерді талдау протоколдары болмаса, белгілі бір сигналдың орнына шуды қуып уақытты жоғалтуыңыз мүмкін. Сонымен қатар, барлық клондарды сынаумен қатар, оңтайлы жұмыс концентрациясын анықтау үшін оларды титрлеу керек. Мен супты алғаш рет сынаған кезде ақымақ сияқты көрінетін көптеген антиденелерді көрдім, бірақ 100 немесе 1000X сұйылтылған олар таза, ерекше және әлі де күшті. Шыдамды болыңыз, тестілеу - бұл көп жұмыс және сіздің нәтижелеріңізді растау үшін бірнеше тонна қайталауды қажет етеді, бірақ соңында бұл жақсы болады.

Соңында, мұның бәрі жасалғаннан кейін, сізде қалаған нәрсені жасайтын және басқалардан жақсырақ керемет клон болады деп үміттенеміз. Енді сіз онымен не істейтініңізді шешуіңіз керек, өйткені сіз академиялық зертхана болсаңыз және онымен бірге жарияласаңыз, әлем сіздің есігіңізді қағады. Соңында асықпаңыз және 100 мл супернатант мәңгілікке жетеді деп шешіңіз - клондарды сақтап, оларды ұяшық банкіне салыңыз немесе өндіруші компаниямен коммерцияландыру туралы келісімге қол жеткізіңіз, сондықтан сізге қажет болмас үшін. барлық жұмысты орында!

Бұл көмектеседі деп үміттенемін, егер сізде қосымша сұрақтар немесе алаңдаушылықтар болса, маған хабарлаңыз.


Талқылау

Модульдік pOp6Мұнда берілген /LhGR глюкокортикоидты-индукциялық жүйе күріштегі трансгенді экспрессияның тиімді және сенімді индукциясына мүмкіндік береді (2, 5, 6, 7, 8-суреттер). Жүйе өте сезімтал, DEX наномольдік концентрацияларына жауап береді (Cурет 5) және әртүрлі мақсаттарға сәйкес DEX қолданудың әртүрлі әдістеріне қолайлы. Мысалы, бөлінген тіндер (2-суреттегідей) трансген экспрессиясының тиімді индукциясы үшін регенерацияланатын T0 сызықтарын скрининг үшін пайдаланылуы мүмкін, су астындағы талдаулар (8-суреттегідей) индукцияланған ген белсенділігінің тікелей төменгі ағынындағы мақсаттарды/әсерлерді анықтау үшін пайдаланылуы мүмкін. , және 0,01 мкМ DEX құрамындағы ортадағы өсу (5-суреттегідей) индукцияланған геннің тамыр дамуына әсерін талдау үшін пайдаланылуы мүмкін. Өсімдіктердің дамуы кезінде гендердің бақыланатын индукциясы қиынырақ болады, бірақ DEX концентрациялары олардың дамуын индукциялау үшін қажет. pOp6 өсіндідегі промотор, қоректік ортаға енгізілгенде өсуді тежейді (3, 4-сурет & 6-сурет). Қоректік ортаға IPTG қосу LhGR уытты әсерін жақсартатынына қарамастан (4 және 6-суреттер), трансген экспрессиясын барынша арттыру және өсу ақауларын азайту үшін DEX-тің IPTG-ге қатысты салыстырмалы концентрацияларын әрбір трансгендік сызық үшін калибрлеу қажет болады. Яғни, DEX-индукцияланған LhGR байланысын өшіру lacO- күріш геномындағы сайттарға ұқсас, сонымен бірге олармен тиімді байланысуға мүмкіндік береді pOp6 трансгендегі промотор. Ең бастысы, өрнектен өте аз көрініс байқалды pOp6 Т1 трансгендік тұқымның табысты жиналуын қамтамасыз ете отырып, Т0 өсімдіктерін регенерациялау арқылы потенциалды өлімге әкелетін трансгендерді тасымалдауға мүмкіндік беретін индуктор болмаған кезде промотор.

күріште байқалған ауыр ақаулар pOp610 мкМ DEX өсуден кейінгі /LhGR трансгенді сызықтары күтпеген болды, өйткені стероидтың ұқсас концентрацияларының әсер ететіні хабарланбаған. pOp6Темекі немесе арабидопсистің LhGR линиялары [5, 6]. Шынында да, pOp6/LhGR жүйесі алғаш рет GVG транскрипциялық активаторын туысқандықпен қолданатын қолданыстағы DEX-индукциялық жүйе проблемасын шешу үшін әзірленді. GAL4 промотор [23], арабидопсис, күріш және өсу ақауларына жиі әкелді Лотос жапон [8, 14, 15]. Бұл өсу ақауларының молекулярлық негізі анықталмағанымен, GVG активаторы өсімдік геномындағы реттілік гомологиясы бар cis-реттеу элементтерімен байланысады деп ұсынылды. GAL4 [15]. GVG активаторы ашытқы GAL4 транскрипция факторының ДНҚ-байланыстырушы доменінен, VP16 герпестік вирустық ақуыздың белсендіру доменінен және LhGR-дегідей GR доменінен тұрады [23]. Gal80 ингибиторын мақсаттан тыс GAL4 байланысуын титрлеу үшін [24] IPTG осы жерде тиімді антагонист ретінде пайдаланылғандай пайдаланылуы мүмкін. LacI LhGR-де ДНҚ байланыстыру домені (4, 6-суреттер), бірақ Gal80 ген бірге экспрессиялануы керек еді өсімдіктерде және белсенділікті модуляциялау қиын болуы мүмкін. The pOp6/Осы жерде хабарланған LhGR жүйесі қазіргі уақытта күріште қолдану үшін ең жақсы таңдау болып табылады, сондықтан индукцияланған ген экспрессиясының фенотиптік әсерлерін LhGR экспрессиясының ұқсас деңгейлері бар бақылау сызықтарымен салыстыру арқылы LhGR спецификалық емес әсерлерінен ажырату қажет екенін ескертеді. ағынында қызығушылық тудыратын ген жоқ pOp6.

генерациялау үшін пайдаланылған модульдік Golden Gate клондау стратегиясының арқасында pOp6Мұнда хабарланған /LhGR конструкциялары, әрі қарай оңтайландыру үшін жүйені оңай өзгерту мүмкіндігі бар. Мысалы, LhGR белсенділігін кеңістіктік бақылау үшін бір LhGR модулімен қызығушылық тудыратын бірнеше гендер бір уақытта индукциялануы мүмкін және/немесе тінге тән промоторлар қосылуы мүмкін. Барлық жағдайларда интрондарды конструкцияларға енгізу кезінде абай болу керек, өйткені олардың ішіндегі реттеуші реттіліктер индукциямен де, индукциясыз да ген экспрессиясын күшейтуі мүмкін [25]. Баламалы тәсіл күріш геномына ортогональды және DEX қолданбасының мақсаттан тыс әсерлерімен бұзыла алмайтын синтетикалық жүйені құру болады. Синтетикалық жүйеде dTALE [26] сияқты транскрипциялық активаторлар күріш геномында жоқ бірегей промоторлар тізбегін байланыстыруға арналған және активатор осында қолданылатын GR тізбегімен біріктіріледі. Шынында да, бұл тәсіл таңдаудың кез келген түрі үшін ортогональды жүйені жобалау үшін пайдаланылуы мүмкін.


Нәтижелер

CH1 изотипі - шырышты FabA-ның FabG-ге ауысуы

CH1 доменінің шырышты Ab спецификасы мен қызметіндегі рөлін бағалау үшін екі FabA клондары, атап айтқанда 43 және 177 зерттелді. Бұл FabA бұрын [3] HESN FabA кітапханасын B gp41 мембранасының проксимальды ұзартылған аймағында (MPER) P1 [19,20] немесе оның MPER [3] үшін жойылған рекомбинантты B gp41 класында скрининг арқылы алынған болатын. Молекулалық деңгейде FabA 43 соматикалық мутациялардың жоғары дәрежесіне, bNAb IgG 10E8 [21] ұқсас VH3 ауыр тізбегінің ұрық сызығының шығу тегі және 22 қалдықтан тұратын ұзын CDRH3, басқа bNAb IgG [3] сипаттамаларына ие. Керісінше, FabA 177 ауыр тізбектегі соматикалық мутациялардың төмен деңгейі, IGKVID-30*-01 ұрық сызығы гендік аймағымен 100% гомология және 11 қалдықтың қалыпты ұзындығы CDRH3 [3]. Сонымен қатар, FabA 177 ауыр тізбегі ешқашан bNAb IgG-мен байланыспаған ұрық тегі VH6 отбасынан шыққан. Әрбір FabA гендік инженерия арқылы сәйкес FabG-ге айналдырылды, CH1α1 CH1γ1-ге ауыстырылды және Материал және әдістер бөлімінде сипатталғандай ұқсастық хроматографиясы арқылы тазартылды. Әрбір жұпта изотиптер бірдей VH және VL домендерін және CH1 доменімен ғана ерекшеленетін бірдей жеңіл тізбекті бөліседі.

FabA және FabG байланысуы және АИВ-1 конвертіне жақындығы

Алдымен біз FabA және FabG байланысуын АИВ-1 класының В [20] және АИВ-1 А және С кластарынан алынған gp140 рекомбинантты тримерлі gp41, үш негізгі АИТВ класынан алынған gp140-пен салыстыру арқылы класс ауыстырып-қосу IgA бастапқы байланыстыру қасиеттерін сақтай ма, соны бағаладық. -1 класс бүкіл әлемде кең таралған. Анықтау үшін қолданылатын әртүрлі изотипке тән антиденелер енгізген ауытқуды болдырмау үшін ELISA-да gp41-мен байланысуы тінтуірдің адамға қарсы каппа жеңіл тізбегі арқылы анықталды [12]. FabA 43 және 177 R5 және X4 тропикалық вирустарынан B gp41 класындағы конформациялық сақталған аймақтарды таниды [12]. Біз FabA және G жұптары B gp41 класына, сондай-ақ A және C gp140 кластарына дозаға тәуелді түрде қосылатынын анықтадық, бірақ таңқаларлық, FabA 43 және 177 байланысуы олардың жұптарымен салыстырғанда тиімдірек. сәйкес FabG (сурет 1A және 1B). Демек, FabA 43 (1мкг/мл) B gp41 класының бірдей байланысуына жету үшін FabG 43 (50мкг/мл) 50 есе жоғары концентрациясы қажет (1А-сурет). FabA мен G 177 арасында байқалған айырмашылықтар одан да үлкен, изотиптер арасында FabA пайдасына 500 есеге жетеді (1В-сурет). Сол сияқты, A және C gp140 класының тұрақты мөлшеріне байланыстыру үшін FabG 43-тен (1А-сурет) 10 есе аз FabA 43 және FabG 177-ден (1В-сурет) 50-100 есе аз FabA 177 қажет болды. Лизоцимге тән Fab-IgA D1.3 [3] және теріс бақылау құралы ретінде пайдаланылған қатысы жоқ Fab-IgG B gp41 класын да, А және С gp140 класын да танымайды.

43 және 177 клондарының FabA және G Gp41 кладтары А, В және С АИВ конвертімен дозаға байланысты байланысады. А және В: A gp140 (қызыл), B gp41 (көк) класы C gp41 (жасыл) үшін FabA (тұтас сызық) және FabG (нүкте сызық) ерекшелігі ИФА әдісімен бағаланды. FabA және G изотиптерін тікелей салыстыру үшін анықтау антикаппа жеңіл тізбегі арқылы орындалды. Арнайы байланыстыру (OD450 нм) Fab концентрациясының (мкг/мл) функциясы ретінде сызылған. Мәндер екі данада орындалған 3 тәуелсіз эксперименттен алынған орташа ± SEM мәнін білдіреді. (A) Fab 43, (Б) Fab 177. C: FabA 43 (тұтас сызық) және FabG 43 (нүктелі сызық) пептидінің P1 крест линиясы, атап айтқанда A (қызыл), В тобы (көк) және С класы (жасыл) үшін ерекшелігі ИФТ әдісімен бағаланды. Екі данада орындалған үш тәуелсіз эксперименттің бір өкілі көрсетілген. D және E: 43 және 177 клондарының FabA және G АИВ-1 жұқтырғандарымен байланысуы CD4 + Т-жасушалар. 43-клондардан FabA (қатты жолақтар) және FabG (штрихталған жолақтар)D) және 177 (Е) 4°C түнде теріс бақылау ретінде А (қызыл) немесе В класы (көк) және С класы (жасыл) АИВ жұқтырған жасушалармен немесе жұқтырмаған жасушалармен инкубацияланды. Теріс бақылаулар ретінде сәйкес емес IgA және IgG пайдаланылды. Арнайы байланыс FabA және G изотиптерін тікелей салыстыруға мүмкіндік беру үшін FITC конъюгацияланған адамға қарсы каппа жеңіл тізбегі арқылы анықталды және Материалдар мен әдістер бөлімінде көрсетілгендей ағындық цитометрия арқылы талданды. Мәндер АИВ-1 жұқтырған (Gag-p24+) CD4+T-жасушалары арасындағы Fab+± SEM % білдіреді. Барлық Fabs жұқтырмаған жасушалармен байланысуы шамалы болды. Сәйкес емес IgA және IgG-нің жұқтырған жасушалармен байланысуы ол 1% деңгейінде бекітілді және n = 3 тәуелсіз тәжірибенің арнайы байланысу мәндерінен шегерілді. Студенттің t – сынағы, * = p<0,05.

Әрі қарай, сенсорлық чиптің бетінде иммобилизацияланған B gp41, A немесе C gp140 класына FabA және G ұқсастығын салыстыру үшін кинетикалық тәжірибелерде беттік плазмонды резонанс (SPR) пайдаланылды. Әртүрлі концентрациялардағы FabA және FabG 43 және 177 талданатын заттар болды. Нәтижесінде (1-кесте және S1-сурет), B gp41 тобы мақсат ретінде қызмет еткенде, KD FabA 43 үшін 3,62 нМ және FabA 177 үшін 21,2 нМ, олардың сәйкес FabG үшін 1,12 және 1,22 мкм салыстырғанда. A және C gp140 класы мақсат ретінде қызмет еткенде, KD FabA 43 үшін 500 нМ-мен салыстырғанда 6,41 және 4,79 нМ болады және жұпталған FabG 43 үшін сәйкестік өлшенбейді. KD FabA 117b үшін 0,29 және 21,5 нМ-ге тең. А немесе С класындағы вирустық конверттерге өлшенетін жақындығы жоқ.

Тұтастай алғанда, барлық класстардың АИВ конверттері үшін аффинділік FabA 43 және 177 клондарының екеуі үшін де nM диапазонына жетеді, бұл басқа bNAbs [22] сияқты, ал ол сәйкес FabG үшін μM тәртібінде қалады немесе одан да төмен болады. ELISA көмегімен байланыстыру эксперименттері (1-сурет). Маңыздысы, бірге алынған барлық Fabs үшін ұқсастық ELISA анықтаған байланысумен корреляцияланады (spearman r = 0,606 p = 0,0375)

FabA және FabG P1 пептидімен байланысуы

35 аминқышқылды пептид P1 вирустық конверттің ең аз мембраналық проксимальды сыртқы аймағы ретінде сипатталды, ол АИВ-1 галактозил керамидімен, АИВ-1 шырышты рецепторымен байланысуға және трансцитоз арқылы АИВ-1 шырышты қабатына енуге мүмкіндік береді [23] –25]. Бұл жоғары деңгейде сақталған аймақ АИВ-1-ге қарсы профилактикалық вакцинада иммуноген ретінде клиникаға дейінгі және клиникалық I фазалық сынақтарда қолданылды [20,26]. P1 тізбегі В класы мен А вирустары арасында жақсы сақталған, ал С класындағы K670S мутация bNAb 2F5 IgG байланысуына кедергі жасайды [27]. FabA 43 B P1 класындағы FabA HESN кітапханасын скрининг арқылы алынды және, тиісінше, FabA 43 B P1 сыныбымен байланысады [3]. ЯМР зерттегенде, P1 3-өлшемді құрылым сызықты емес, бірақ иілу арқылы бөлінген 2 спиралдан тұрады [28]. Осылайша, біз сипатталғандай [3] салыстырмалы түрде A, B және C P1 кладтарымен байланысу үшін FabA және G 43 қабілетін ELISA арқылы бағаладық. FabA және G 43 изотиптерінің екеуі де дозаға тәуелді түрде A, B және C P1 топтарымен байланысады (1С-сурет). Бір қызығы, жоғарыда көрсетілгендей, P1 пептиді толық ақуыз контекстінде көрсетілгенде (1А-сурет), FabA 43 P1-ді сәйкес FabG-ге қарағанда тиімдірек таниды (1С-сурет). Бұл айырмашылық B P1 класы нысана болған кезде жоғары болады (FabA-дан G-ге 60 есе өзгерісімен), бірақ A және C топтары нысана болған кезде әлі де маңызды (FabA-дан G-ге 20 есе өзгеруімен) (1С-сурет) . Сонымен қатар, FabA және FabG 43 A және C P1 кластарымен салыстырғанда B қабатымен тиімдірек байланысады (1С-сурет). Fab изотипінің P1-мен үш кладпен байланысуындағы бұл айырмашылықтар SPR арқылы да байқалады (S2 сурет).

Жалпы алғанда, FabA 43 nM диапазонында ұқсастығы бар FabG аналогтарына қарағанда, gp41 суббірлігі P1 кросс-кластарын тиімдірек байланыстырады.

FabA және FabG АИВ жұқтырған CD4 + Т-жасушаларымен байланысуы

Содан кейін біз Fabs A класы (бастапқы изолят 92UG031), B (бірінші оқшауланған JR-CSF) немесе C вирусы (бастапқы) жұқтырған CD4 + Т-жасушаларының бетіндегі тримерикалық ұштық конформациясында вирустық конвертпен байланысу қабілетін бағаладық. оқшаулау 92BR025). Түрлі Fabs-пен 4°C түнде инкубациялаудан кейін байланыстыру изотипті тікелей салыстыруға мүмкіндік беру үшін каппаға қарсы жеңіл тізбекті қайталама антидененің көмегімен ағынды цитометрия арқылы бағаланды. Барлық Fabs АИВ-1 жұқтырған жасушаларды арнайы байланыстырады, дегенмен FabGs-тің C класы және А класы АИВ-1 жұқтырған жасушаларымен байланысуы FabA-мен салыстырғанда әлдеқайда төмен. АИВ жұқтырған Т-жасушаларының 20-дан 40%-ға дейін FabA үшін таңбаланған, FabG үшін 5-19% (студенттік т–тест, p<0,05) (1D және 1E-сурет). FabA 43 B класы мен С жұқтырған CD4 + T-жасушаларына қарағанда A- класын тиімдірек таниды (1D-сурет), ал FabA 177 кластары арасында ешқандай айырмашылықтар байқалмады (1E-сурет). Маңыздысы, АИВ-1 жұқтырған жасушалармен Fab байланысуы Fab аффинділігімен және ELISA арқылы өлшенген АИВ-1 конвертімен байланысуымен (1A–1C сурет) (spearman r = 0,777 p = 0,0156) (2F-сурет).

Fab 43 және 177-A және -G вирусқа қарсы тиімділігі A, B және C HIV-1 кластарына қарсы. (А және Б) Fab 43 арқылы АИВ-1 инфекциясының дозаға тәуелді тежелуі (А) және Fab 177 (Б) CD4 + Т-жасушаларында p24 бояуын қолдана отырып, бір циклды инфекциялық талдауда бағаланды. Әрбір Fab клоны үшін FabA (тұтас сызық) және FabG (нүкте сызық) 37°C температурада АИВ-1 класы А (қызыл), В класы (көк) немесе С (жасыл) класымен инкубацияланды. CD4 + Т жасушаларын қосқанға дейін 36 сағ. Теріс бақылаулар ретінде ұқсас концентрациялардағы сәйкес емес Fab-IgA (қатты сұр сызық) және Fab-IgG (нүктелі сұр сызық) пайдаланылды. Материалдар және әдістер бөлімінде көрсетілгендей ағынды цитометрия арқылы талданған бейтараптандыру пайызы Fab жоқ кезде АИВ-1 жұқтырған жасушалармен салыстырғанда Gag-p24 + АИВ-1 жұқтырған жасушалардың азаюы ретінде анықталды. Мәндер үш көшірмеде орындалған кемінде 4 тәуелсіз эксперименттен алынған орташа ± SEM мәнін білдіреді. Студенттің t–тесті, * = p<0,01 ** = p<0,001 *** = p<0,00001. (C және D) LC-дан аутологиялық CD4 + Т-жасушаларына АИВ-1 тасымалдануын тежеу ​​5-ші күні LCs/T-жасушалық ко-культуралар шығаратын p24-ті өлшеу арқылы бағаланады. А (қызыл), В (көк) класындағы АИВ-1 немесе C clade (жасыл) Fabs (FabA тұтас сызығы, FabG нүктелі сызығы) және CD4 + T-жасушаларын қоспас бұрын 2 сағат бойы LC-мен алдын ала инкубацияланды. Теріс бақылаулар ретінде ұқсас концентрациялардағы сәйкес емес Fab-IgA (қатты сұр сызық) және Fab-IgG (нүктелі сұр сызық) пайдаланылды. LC-T жасуша кокультуралары 37°C температурада 7 күн бойы инкубацияланды. Fab жоқ LC–T кокультуралары LC-дан аутологиялық CD4 + T-жасушаларына 100% АИВ-1 трансферті болып саналды. Вирустың тасымалдануы Материал және әдістер бөлімінде сипатталғандай ELISA әдісімен p24-Ag өлшеу арқылы бағаланды. Нәтижелер Fabs қатысуымен тасымалдаудың % тежелуіне сәйкес келеді. Мәндер үш көшірмеде орындалған кемінде бес тәуелсіз эксперименттің орташа ± SEM мәнін білдіреді. Студенттің t – сынағы, * = p<0,01** = p<0,01. (E) АИВ-1 бейтараптандыру белсенділігі мен тасымалдауды тежеу ​​арасындағы корреляция. 100 нг/мл-де 43 және 177 FabA және G клондары үшін өлшенген бейтараптандыру және тасымалдауды тежеу ​​өзара байланысты болды. Спирмен дәрежесінің r корреляциясы және сәйкес мәндері көрсетілген. (F) Әрбір клонның 43 және 177 әрбір талдауындағы өнімділік арасындағы корреляция. Әрбір клонның жұпталған FabA және G үшін әрбір көрсетілген талдауда алынған мәндердің қатынасы толық байланыс кластерлеу әдісін және Спирман статистикасына сәйкес рейтингті пайдалана отырып, жылу картасы ретінде алынды және сызылды. Байланыстыру 1/АИВ конвертінің ELISA OD мәндерін білдіреді Сәйкестік 1/log KD мәндеріне сәйкес келеді.

FabA және FabG вирусқа қарсы қасиеттері

АИВ-1 CD4 + Т-клетка инфекциясын FabA және FabG арқылы бейтараптандыру.

As FabA and G only differ by the CH1 domain, the results presented above suggest that the CH1 domain affects the paratope fitting on the antigen that might, in turn, impact the Ab anti-viral function in an isotype-dependent manner.

Therefore, we first investigated the impact of the CH1 isotype in Fab-neutralizing activities. Using a panel of three viruses from clade A, B and C, neutralization of CD4 + T lymphocytes infection by both FabA and G pairs was tested as previously described [3]. Serial dilutions of each FabA and G were assessed comparatively, and IC50 values were determined for each HIV-1 clade. Comparative evaluation of paired Fab 43 isotypes reveals that FaA 43 neutralizes all three A, B and C clades with a respective IC50 of 1ng, 1μg and 100ng/ml, whereas FabG 43 only neutralizes clade A virus with an IC50 of 100ng/ml but not clades B or C virus (Fig 2A). A similar neutralization pattern is observed for the clone 177 with an IC50 of 1ng, 300ng and 30ng/ml for FabA 177 against clade A, B and C virus respectively and an IC50 of 100ng and 1μg for FabG 177 against clade A and C virus, respectively (Fig 2B). In all cases, the paired FabA has significantly-increased neutralization compared to its paired FabG for all concentrations evaluated (Student’s т–test, p values ranging from p<0.01 to p<0.00001). Irrelevant Fab-IgA and Fab-IgG, used as negative controls in parallel experiments lack neutralizing. Of note, cross-neutralization of the Fab we report is based on only one isolate of each clade and should be confirmed on more isolate per clade in future studies.

In summary, for all three HIV-1 clades tested, the CH1α confers to FabA the capacity to neutralize CD4 + T-cell infection whereas the corresponding FabG harboring the same paratope but a different CH1, namely CH1γ, has limited neutralizing activities.

Blockade of cell-to-cell virus transfer by FabA and FabG.

Cell-to-cell transmission of HIV-1 is of major importance in vivo, being much more efficient than infection by cell-free virions [29]. At the mucosal level, HIV-1 entry through multilayer mucosal tissues occurs mainly by targeting Langerhans cells (LCs) that in turn, transfer to CD4 + T-cells [30–33], which constitute the founder-infected cell population. In turn, CD4 + T-cells migrate out of the mucosal tissue, further spreading the virus. Thus, we evaluated the capacity of both pairs of HESN Fabs to block clades A, B and C virus transfer from LCs to CD4 + T-cells. Transfer of clade A and C HIV-1 is inhibited by both FabA 43 and 177 in a concentration-dependent manner, as well as that of clade B by FabA 43, inducing a >40% inhibition at 100ng/ml. Transfer of clade B virus remains much less sensitive to FabA 177 (Fig 2C and 2D). FabG 43 blocks transfer of clade A and C viruses but less efficiently than its FabA counterpart (Fig 2C), and FabG 177 was only able to block clade A HIV-1 transfer (Fig 2D). Irrelevant Fab-IgA and Fab-IgG, used as negative controls, fail to interfere with HIV-1 transfer from LCs to CD4 + T cells.

Of note, taking all the values into consideration (including all viral clades and Fab isotypes) together, at 100ng/ml of Fab, neutralization capacity correlated directly with inhibition of virus transfer (spearman r = 0.6655, p = 0.0219) (Fig 2E).

Taken together, this series of functional analyses demonstrates that switching the CH1α from a mucosal Ab to CH1γ, considerably reduces the Fab antiviral properties, namely both neutralization and HIV-1 transfer from LCs to CD4 + T-cells (Fig 2F).

Identification of FabA- and G-specific mimotopes

The molecular basis by which the CH1 region impacts antibody affinity and functions, could be due to selective molecular stringency/flexibility imposed by the CH1 domain on the paratope conformation. Thus, we aimed to determine the conformational epitopes specific for each Fab isotype, namely clones 43- and 177-specific FabA and FabG.

Consequently, a 12 mer random peptide library was used to characterize a set of the best specific peptides, referred to as mimotopes, of both 43 and 177 clones as FabA and FabG using three rounds of successive screening with increasing stringency, as we have previously described [12]. After sequencing 100 phages specific for each of the Fabs, none of the selected mimotopes correspond to linear sequences of gp41, indicating that Fab epitopes are conformational, as already suggested [3]. Whereas a larger set of mimotopes with high occurrence were retrieved on each of the FabA, a limited number of different phage-expressing peptides bound to FabG, in line with the lower affinity of the FabGs compared with FabAs for gp41 (S1 and S2 Tables).

Conformational FabA and G epitope mapping

The strategy we used to characterize conformational epitopes corresponding to each set of mimotopes, using кремнийде approaches, is based on mimotope mapping onto trimeric gp41 crystal structures, as described in the Material and Methods section and supplementary data. When experimental techniques such as X-ray crystallography of antibody-antigen interactions turn difficult to use [34], such as in the present case, and when the structure of the target is known, кремнийде approaches can provide an appropriate means to identify candidate epitopes to be further tested [35], for instance by competition experiments. Only two gp41 crystal structures of a clade B, but not clade A or C gp41, each in a different conformational state, are available. One structure represents gp41 in the pre-fusion state, together with gp120, although this gp41 lacks the MPER region [36]. The other gp41 structure mimics the 6-Helix bundle state and is composed of three N-helices and three C-helices that form a six helix-bundle for completion of HIV-1 fusion with target cells in a “spring-loaded” model of fusion. In this case, the gp41 construct lacks the gp41 Cys-loop bridging the C and N helices [37].

As Fab 43 is primarily specific for the gp41 MPER [3] and the Cys-loop contains important gp41 epitopes [38], we reconstructed кремнийде the missing parts of clade B gp41 as described in the Material and Methods section using our recently-developed approach [39]. Hence, we first optimized the available crystal structure of gp41 clade B by reconstituting the missing MPER in the pre-fusion structure and the missing loop in the 6-Helix bundle as described in the supplementary data.

Furthermore, as no crystal structures of clade A or C are available in the literature, we constructed clade A and clade C gp41 structures by mapping each of clade A and clade C gp41 sequences onto the clade B gp41 structures, as detailed in the supplementary data. As a result, from these кремнийде modeling calculations, simulation of clade A, B and C gp41 structures in the pre-fusion and 6-Helix bundle conformations were available for epitope mapping studies.

Selected FabA-specific mimotopes, obtained from FabA 43 and 177, were localized on clade A, B and C gp41 pre-fusion and 6-helix bundle structures, using the PEPsurf method as detailed in supplementary S3 Fig. Two main regions are targeted by FabA 43 mimotopes on gp41 6-helix bundle structure of all three clades, the highest hits being localized on the lower MPER region interface with the N-helix (Fig 3A), in agreement with the screening strategy focusing on P1, used for selecting FabA 43 [3]. In comparison, FabA 43 mimotopes only fit on the clade B pre-fusion structures and with lower scores (Fig 4A). Furthermore, mimotopes fit on each gp41 with slight differences as recapitulated in S3 Table.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (А) and 177 ) were docked on the crystal structure of gp41 under its 6-Helix bundle conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized in a color scale according to the scores returned by the PEPsurf algorithm at each position of the sequence (mean of the 3 chains, over 15 conformations extracted each 10 ns from the molecular dynamic simulations) for each set of mimotope. A common color scale varying from never (yellow) to the most frequent on all clades and structures (red) is used, allowing to directly compare epitopes on the three gp41 clades. For each score, a set of random sequences at each position of the sequence had been subtracted to remove background noise.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (А) and 177 (Б) were docked on the crystal structure of gp41 under its trimeric pre-fusion conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized as described in Fig 3 using the same scale to facilitate direct comparison.

The main region targeted by FabA 177 mimotopes on gp41 6-helix bundle structures of all three clades, differs from those targeted by FabA 43 mimotopes, as expected [3]. FabA 177 mimotopes best fit the loop linking the N and C gp41-helices (Fig 3B). These FabA 177-specific mimotopes target an additional domain overlapping the regions mapped by FabA 43 mimotopes, although identified with a much lower score that might not be biologically relevant. Finally, these FabA 177 mimotopes also match gp41 pre-fusion structures as detailed in S2 Table, but with lower scores than the 6-Helix bundle and in a more scattered pattern, irrespective of the clade (Fig 4B) and thus with limited biological relevance.

When FabG sets of specific mimotopes were analyzed similarly, numerous regions were targeted on the various gp41 structures. Corresponding scores might not be relevant biologically, in agreement with the low affinity of FabGs for gp41 and the low number of mimotopes retrieved compared to FabAs. We therefore concentrated our analysis on the FabA 43 and 177 mimotopes.

Design of peptides recapitulating FabA conformational epitopes

To validate experimentally, the FabA conformational epitopes defined кремнийде as described above, we designed peptides that mimic each conformational FabA epitope and evaluated their capacity to bind their corresponding FabA. To construct these peptides, additional bioinformatic analyses were conducted for each mimotope independently as described in the Material and Methods section.

From these analyses, five peptides specific for FabA 43, namely P7 to P11 could be designed (S4 Table). All of these Fab43 specific peptides appear compatible with the 3-dimensional 6-Helix bundle conformations in all three clades, except P8 which targets only the clade A pre-fusion conformation.

When tested at the biological level for FabA specificity, one out of the five conformational epitopes defined кремнийде for FabA 43, encompassing regions on both the gp41 N and C-Helixes with LWNWFDISAASI as sequence, and referred to as P7, competes significantly with FabA 43 binding to P1 and gp41/gp140 of the three clades in ELISA when preincubated with the FabA 43 (Figs 5A and S3A) in a concentration-dependent manner (Fig 5B). P7 at 5 μM blocks FabA 43 binding by >50%, reaching >80% at 10μM (Fig 5B). A 9 amino acid peptide derived from the influenza virus hemagglutinin (HA) used as negative control, does not interfere with FabA 43 binding in ELISA (Fig 5A). In contrast, peptide P7 does not interfere with FabG 43 binding to the same antigens (not shown). Taken together, these results indicate that P7 interferes with FabA 43 cross-clade.

(A) Preincubation of FabA 43 with the conformational epitope P7 (5 μM, hatch bars) but not with control HA (5μM, plain bars) interferes significantly with FabA 43 binding to clade A (red), clade B (blue) and clade C (green) P1 of clades A and C gp140 and clade B gp41, as evaluated by competition ELISA as described in Material and Method section. FabA 43 preincubated with P7 or control HA were added to gp41 clade B, gp140 (clades A, C) or P1 (clades A, B, C) coated on the ELISA and their binding was detected by using HRP-coupled anti-human IgA. The percentage of binding was calculated relative to the binding of Fab in the absence of the P7 or control HA. (B) The P7-induced reduction of FabA 43 binding to each antigen is dose dependent. Competition ELISA was done in the same conditions described in A. Binding inhibition to FabA 43 binding to each antigen in the presence of P7 is calculated relative to the binding inhibition in the presence of the irrelevant HA peptide serving as negative control. In A and B, values represent mean ± SEM, derived from 3 independent experiments performed in triplicate. (C) Localization of the amino acid paths corresponding to P7 peptide on the 6-Helix bundle conformation of clades A, B and C gp41 frame15. Each gp41 monomer of the trimer is depicted using a different level of gray. The amino acid paths corresponding to the FaA 43-specific peptide P7 are highlighted in orange. Note residues 532–535 belong to the N-Helix of one monomer while residues 669–672 belong to the C-Helix of another monomer of the trimer. Red: the P7-predicted conformation, superimposed on the structure of gp41. RMSD values over the paired residues of gp41 and P7 are of 2.45, 2.97 and 1.97 Å for clade A, B and C, respectively. Note that in this region of the gp41, only residue 535 differs between clade B in one hand and clade A and C in the other hand. (D) Conformational variability of the predicted conformations of P7 using PEP-FOLD3. Left: conformation best fitting gp41. Right: top 10 predicted conformations superimposed. (E) Interference of FabA 43 neutralization by a 400-fold molar excess of P7 peptide. FabA 43 preincubated with P7 or control HA were incubated with the HIV-1 of one of each three clades (A, B, C) before adding the activated CD4 + T cells, and cultures were incubated at 37°C for 2 days. Cultures without Fab were served as positive control of infection. The percentage of neutralization, analyzed by flow cytometry as indicated in Materials and Methods section, is shown relative to FabA 43 neutralization using primary CD4 + T cells in the presence of the irrelevant HA peptide, tested in parallel. Values represent mean ± SEM, derived from 3 independent experiments performed in triplicate.

The 12 aminoacid peptide P7 recapitulates a region located at the interface formed by the tips of N- and C-helix of the three clades of gp41 (Fig 5C and 5D). Although P7 has been defined as the best conformational epitope extracted by кремнийде analyses from FabA 43 mimotope fitting to the 6-Helix bundle clade A gp41 structure, this cross-clade reactivity is expected. Hence, the P7- corresponding region in clade B and C is similar in sequence, although it harbors a I535M substitution in clade B. Our predictions support the hypothesis that P7 mimics a patch on gp41 surface involving two different monomers of the gp41 6-Helix bundle, suggesting that FaA 43 could freeze gp41 in the 6-Helix bundle conformation, thereby preventing further conformational changes of the trimer assembly. The other four conformational peptides defined кремнийде for FabA 43 that do not interfere with FabA 43 binding to the gp41 antigens are located on different regions of gp41, regardless of the gp41 clade. As two of them are spatially close from the region defined by P7 (S4 Fig), it suggests that the region mapped by P7 on gp41 is highly specific for FabA 43 binding to the HIV-1 envelope. Furthermore, at the functional level, preincubation of FabA 43 with a 400- fold molar excess of P7 blocked the FabA 43 HIV-1 clades A, B and C neutralizing activities with an efficacy of 33±5, 54±8, and 24±11%, respectively (Fig 5E). These results are in good agreement with the antigen-binding blockade observed in ELISA (Fig 5A and 5B).

Finally, six conformational epitopes, referred to as P0 to P6, that best mimic each set of mimotopes specific for FabA 177, were also designed for each gp41 conformation and clade (S2 and S3 Tables). The six peptides extracted from this analysis are compatible with the 3D conformations of at least two clades and interfere all, although to different degrees, with FabA 177 binding to gp41/gp140 of clades A, B and C, with a maximal binding inhibition limited to 23% (S3B Fig). However, no interference was observed with FabA 177 neutralizing activity against HIV-1 of clades A, B and C.


16.3 Қан айналымы және тыныс алу жүйесі

Жануарлар – қоректік заттарды бүкіл денесіне тасымалдау және қалдықтарды шығару механизмін қажет ететін күрделі көп жасушалы организмдер. Адамның қан айналымы жүйесінде дененің барлық бөліктеріне жететін қан тамырларының күрделі желісі бар. Бұл кең желі жасушаларды, тіндерді және мүшелерді оттегімен және қоректік заттармен қамтамасыз етеді, көмірқышқыл газы мен қалдықтарды кетіреді.

Газдар мен басқа молекулаларды тасымалдау ортасы жүйе арқылы үздіксіз айналатын қан болып табылады. Жүйедегі қысым айырмашылықтары қанның қозғалысын тудырады және жүректің соғуы арқылы жасалады.

Тіндер мен қан арасындағы газ алмасу қан айналымы жүйесінің маңызды қызметі болып табылады. Адамдарда, басқа сүтқоректілер мен құстарда қан оттегін сіңіріп, өкпеге көмірқышқыл газын шығарады. Осылайша, қызметі оттегін алу және көмірқышқыл газын шығару болып табылатын қан айналымы және тыныс алу жүйесі қатар жұмыс істейді.

Тыныс алу жүйесі

Тыныс алыңыз және оны ұстаңыз. Бірнеше секунд күтіңіз, содан кейін оны босатыңыз. Адам күш жұмсамаған кезде орта есеппен минутына 15 рет тыныс алады. Бұл сағатына шамамен 900 тыныс алуға немесе күніне 21 600 тыныс алуға тең. Әрбір ингаляция кезінде ауа өкпені толтырады және әр дем шығарған сайын ол қайтадан сыртқа шығады. Бұл ауа кеуде қуысындағы өкпені толтырып, демдеп қана қоймайды. Ауаның құрамында өкпе тінін кесіп өтіп, қанға түсіп, мүшелер мен ұлпаларға баратын оттегі бар. Онда оттегі жасушалық қалдық материал болып табылатын көмірқышқыл газына алмасады. Көмірқышқыл газы жасушалардан шығып, қанға еніп, өкпеге оралады және дем шығару кезінде денеден шығарылады.

Тыныс алу – ерікті де, еріксіз де құбылыс. Қаншалықты жиі тыныс алуды және қанша ауаны жұту немесе шығаруды мидағы тыныс алу орталығы қандағы көмірқышқыл газының мөлшері туралы қабылдайтын сигналдарға жауап ретінде реттейді. Дегенмен, сөйлеу, ән айту және су астында жүзу сияқты әрекеттер үшін бұл автоматты реттеуді жоққа шығаруға болады.

Ингаляция кезінде диафрагма төмен түсіп, өкпенің айналасында теріс қысым жасайды және олар ауаны дененің сыртынан тарта бастайды. Ауа денеге мұрынның дәл ішінде орналасқан мұрын қуысы арқылы түседі (16.9-сурет). Ауа мұрын қуысынан өткенде, ауа дене температурасына дейін жылытылады және шырышты қабаттардың ылғалдылығымен ылғалданады. Бұл процестер ауаны дене жағдайына теңестіруге көмектеседі, суық, құрғақ ауа тудыруы мүмкін кез келген зақымды азайтады. Ауада қалқып жүрген бөлшектер мұрын жолдарында түк, шырыш және кірпікшелер арқылы жойылады. Ауа иіс сезу арқылы да химиялық жолмен алынады.

Мұрын қуысынан ауа жұтқыншақ (тамақ) және кеңірдек (дауыс қорабы) арқылы трахеяға өтеді (16.9-сурет). Трахеяның негізгі қызметі - дем алған ауаны өкпеге жіберу және дем шығарылған ауаны денеден кері шығару. Адамның трахеясы - ұзындығы шамамен 25-30 см (9,8-11,8 дюйм) цилиндр, ол өңештің алдында орналасады және жұтқыншақтан кеуде қуысына өкпеге дейін созылады. Ол шеміршек пен тегіс бұлшықеттің толық емес сақиналарынан тұрады. Шеміршек трахеяға күш пен қолдауды қамтамасыз етеді, бұл өтуді ашық ұстау үшін. Трахея кірпікшелері бар және шырыш бөлетін жасушалармен қапталған. Шырыш деммен жұтылған бөлшектерді ұстайды, ал кірпікшелер бөлшектерді жұтқыншаққа қарай жылжытады.

Трахеяның соңы оң және сол өкпеге кіретін екі бронхқа бөлінеді. Ауа өкпеге біріншілік бронхтар арқылы түседі . Бастапқы бронх бөлінеді де, диаметрі 1 мм (0,03 дюйм) төмен болғанша кішірек және кіші диаметрлі бронхтар жасайды, олар өкпе арқылы бөлініп, таралатын бронхиолалар деп аталады. Трахея сияқты бронх пен бронхиолалар шеміршек пен тегіс бұлшықеттен тұрады. Бронхтар жүйке жүйесінің сигналдарына байланысты бронхтар мен бронхиолдардағы бұлшықеттердің жиырылуын (парасимпатикалық) немесе релаксациясын (симпатикалық) бақылайтын парасимпатикалық және симпатикалық жүйке жүйесінің нервтерімен нервтенеді. Соңғы бронхиолалар тыныс алу бронхиолалары болып табылады. Әр тыныс алу бронхиоласының ұшына альвеолярлы түтіктер бекітілген. Әр түтіктің соңында альвеолярлы қапшықтар бар, олардың әрқайсысында 20-30 альвеола бар. Газ алмасу тек альвеолаларда жүреді. Альвеолалар жұқа қабырғалы және қапшықтардың ішіндегі кішкентай көпіршіктерге ұқсайды. Альвеолалар қан айналымы жүйесінің капиллярларымен тікелей байланыста болады. Мұндай жақын байланыс оттегінің альвеолалардан қанға таралуын қамтамасыз етеді. Сонымен қатар, көмірқышқыл газы дем шығару үшін қаннан альвеолаларға таралады. Капиллярлар мен альвеолалардың анатомиялық орналасуы тыныс алу және қан айналымы жүйелерінің құрылымдық және функционалдық байланысына ерекше назар аударады. Өкпедегі альвеолалардың бетінің ауданы шамамен 100 м 2 шамасында өзгереді. Бұл үлкен аумақ шамамен жарты теннис кортын құрайды. Бұл үлкен бет ауданы альвеолярлы жасушалардың жұқа қабырғалы табиғатымен үйлеседі, газдардың жасушалар арқылы оңай таралуына мүмкіндік береді.

Көрнекі байланыс

Адамның тыныс алу жүйесі туралы берілген тұжырымдардың қайсысы дұрыс емес?


Investigations into the Biosynthesis, Regulation, and Self-Resistance of Toxoflavin in Pseudomonas protegens Pf-5

Pseudomonas spp. are prolific producers of natural products from many structural classes. Here we show that the soil bacterium Pseudomonas protegens Pf-5 is capable of producing trace levels of the triazine natural product toxoflavin (1) under microaerobic conditions. We evaluated toxoflavin production by derivatives of Pf-5 with deletions in specific biosynthesis genes, which led us to propose a revised biosynthetic pathway for toxoflavin that shares the first two steps with riboflavin biosynthesis. We also report that toxM, which is not present in the well-characterized cluster of Burkholderia glumae, encodes a monooxygenase that degrades toxoflavin. The toxoflavin degradation product of ToxM is identical to that of TflA, the toxoflavin lyase from Paenibacillus polymyxa. Toxoflavin production by P. protegens causes inhibition of several plant-pathogenic bacteria, and introduction of toxM into the toxoflavin-sensitive strain Pseudomonas syringae DC3000 results in resistance to toxoflavin.

Түйін сөздер: biocontrol natural products secondary metabolism triazine.


1. КІРІСПЕ

Күріш (Орыза сатива L.) is a widely consumed staple food feeding over half of population in the world, especially in Asia (Dong et al., ( 2018 )). During the past decades, China has successfully promoted the cultivation of hybrid rice by developing heterosis, which has greatly increased rice yield (Duan et al., 2013 ). In spite of this, developing high-yield new varieties remains one of the major problems concerning rice breeders due to the growing consumer demand, decreased arable land, and the gradually deteriorating environment. Except for yield, the improvement of grain quality and appearance are also important concerns in rice breeding (Peng et al., 2016 ). However, it is inefficient to select those traits based on direct field observation due to their complexity and vulnerability to environmental influences. For example, the rice yield trait depends on the synergy of various factors, including the spikelet number per panicle and panicles per plant, grain weight, grain filling, plant height, and panicle length (Duan, 2013 Shen et al., 2018 ), while the grain appearance quality is essentially determined by grain length, grain width, and grain density (Bazrkar-Khatibani et al., 2019 Lou et al., 2009 ). In recent years, the development of DNA markers and linkage maps enables the molecular breeding of rice to split complex polygenic traits into single Mendelian QTL (Lou et al., 2009 Zhang, Chen, et al., 2017 ).

The genotyping-by-sequencing (GBS) technology is a rapid, simple, and low-cost genotyping method based on the next-generation sequencing and has the capacity of identifying a number of DNA sequences near enzyme cleavage sites and single nucleotide polymorphism (SNP) information for a plant species (Elshire et al., 2012 ). It has been wildly used in the construction of the genetic map, the studies of animal/plant population evolution, and the auxiliary genome assembly (Poland & Rife, 2012 Pootakham et al., 2015 ). The high-throughput SNP genotyping method has also been wildly used in the QTL mapping marker-assisted breeding in rice (Angaji, 2009 Zhang et al., 2017 ). Tang and colleagues characterized the genome-wide SNPs of the parental varieties of recombinant inbred line (RIL) populations using the high-throughput GBS and identified a QTL containing the locus Os4g48460 (a putative cytochrome P450) related to rice seed size (Tang et al., 2016 ). Zhu performed QTL mapping in a restorer line of hybrid rice based on ultra-high-density SNP mapping and found 26 QTLs for six yield traits, in which nine QTL alleles presented a significant effect (Zhu et al., 2017 ). Jiang performed the high-density genetic map in the QTL mapping of 124 rice backcrossed recombinant inbred lines and showed six QTLs related to seed germination in response to the cold stress (Jiang et al., 2017 ).

In this study, the F8 recombinant inbred lines (RILs), developed from the cross Dexiang074B and Pujiang6, were used. Dexiang074B, as a high-combining ability hybrid rice maintainer line, is currently one of the rice backbone parents in Sichuan province and combines high grain quality and yield. Its hybrid progeny, Deyou 4727, passed the national examination and approval in 2014 and was named "green super rice" in 2019. As an indica three-line hybrid rice, this variety is widely planted in the upper and middle reaches of the Yangtze River. It has characteristics of large grains, high seed setting rate, high yield (rice yield is up to 15.0 t/ha), excellent rice quality, and moderate resistance to rice blast. Pujiang6, a farm variety with rounded grain appearance, displays great differences with the economic traits of Dexiang074B. To further understand the genetic basis of agricultural traits in the RILs of rice, including heading data, grain length, grain width, thousand kernel weight, grain density, panicle length, the panicle number, and plant height, we performed genome-wide SNP discovery and QTL mapping for the RIL (F8) population using high-density GBS-based SNP linkage mapping. A total of 426 additive QTLs were identified for the eight agricultural traits with different environments or methods. Importantly, 98 highly reliable QTLs can be detected repeatedly by multiple methods or multiple environments. This study provides a genetic basis for developing cultivated rice with economic characteristics based on the molecular breeding technology.


Мазмұны

JAK2 gene fusions with the TEL(ETV6) (TEL-JAK2) and PCM1 genes have been found in patients suffering leukemia, particularly clonal eosinophilia forms of the disease. [11] [12] [13]

Mutations in JAK2 have been implicated in polycythemia vera, essential thrombocythemia, and myelofibrosis as well as other myeloproliferative disorders. [14] This mutation (V617F), a change of valine to phenylalanine at the 617 position, appears to render hematopoietic cells more sensitive to growth factors such as erythropoietin and thrombopoietin, because the receptors for these growth factors require JAK2 for signal transduction. An inhibitor of JAK2-STAT5, AZD1480, was pointed as having activity in primary and CRPC. [15] Jak2 mutation, when demonstrable, is one of the methods of diagnosing polycythemia vera. [16]

Janus kinase 2 has been shown to interact with:

Prolactin signals through JAK2 are dependent on STAT5, and on the RUSH transcription factors. [60]


Мазмұны

Khorana was born to Krishna Devi Khorana and Ganpat Rai Khorana, in Raipur, a village in Multan, Punjab, British India in a Punjabi Hindu family. [9] The exact date of his birth is not certain but he believed that it might have been 9 January 1922 [10] this date was later shown in some documents, and has been widely accepted. [11] He was the youngest of five children. His father was a patwari, a village agricultural taxation clerk in the British Indian government. In his autobiography, Khorana wrote this summary: "Although poor, my father was dedicated to educating his children and we were practically the only literate family in the village inhabited by about 100 people." [12] The first four years of his education were provided under a tree, a spot that was, in effect, the only school in the village. [9]

He attended D.A.V. (Dayanand Anglo-Vedic) High School in Multan, in West Punjab. [9] Later, he studied at the Punjab University in Lahore, with the assistance of scholarships, where he obtained a bachelor's degree in 1943 [12] and a Master of Science degree in 1945. [4] [13]

Khorana lived in British India until 1945, when he moved to England to study organic chemistry at the University of Liverpool on a Government of India Fellowship. He received his PhD in 1948 advised by Roger J. S. Beer. [14] [15] [16] [12] The following year, he pursued postdoctoral studies with Professor Vladimir Prelog at ETH Zurich in Switzerland. [12] He worked for nearly a year on alkaloid chemistry in an unpaid position. [9] [16]

During a brief period in 1949, he was unable to find a job in his original home area in the Punjab. [9] He returned to England on a fellowship to work with George Wallace Kenner and Alexander R. Todd on peptides and nucleotides. [16] He stayed in Cambridge from 1950 until 1952.

He moved to Vancouver, British Columbia, with his family in 1952 after accepting a position with the British Columbia Research Council at University of British Columbia. [12] [17] Khorana was excited by the prospect of starting his own lab, a colleague later recalled. [9] His mentor later said that the Council had few facilities at the time but gave the researcher "all the freedom in the world". [18] His work in British Columbia was on "nucleic acids and synthesis of many important biomolecules" according to the American Chemical Society. [14]

In 1960 Khorana accepted a position as co-director of the Institute for Enzyme research at the Institute for Enzyme Research at the University of Wisconsin at Madison. [14] [19] He became a professor of biochemistry in 1962 and was named Conrad A. Elvehjem Professor of Life Sciences at Wisconsin–Madison. [20] While at Wisconsin, "he helped decipher the mechanisms by which RNA codes for the synthesis of proteins" and "began to work on synthesizing functional genes" according to the American Chemical Society. [14] During his tenure at this University, he completed the work that led to sharing the Nobel prize. The Nobel web site states that it was "for their interpretation of the genetic code and its function in protein synthesis". Har Gobind Khorana's role is stated as follows: he "made important contributions to this field by building different RNA chains with the help of enzymes. Using these enzymes, he was able to produce proteins. The amino acid sequences of these proteins then solved the rest of the puzzle." [21]

He became a US citizen in 1966. [22] Beginning in 1970, Khorana was the Alfred P. Sloan Professor of Biology and Chemistry at the Massachusetts Institute of Technology [23] [12] [24] and later, a member of the Board of Scientific Governors at The Scripps Research Institute. He retired from MIT in 2007. [22]

Har Gobind Khorana married Esther Elizabeth Sibler in 1952. They had met in Switzerland and had three children, Julia Elizabeth, Emily Anne, and Dave Roy.

Ribonucleic acid (RNA) with two repeating units (UCUCUCU → UCU CUC UCU) produced two alternating amino acids. This, combined with the Nirenberg and Leder experiment, showed that UCU genetically codes for serine and CUC codes for leucine. RNAs with three repeating units (UACUACUA → UAC UAC UAC, or ACU ACU ACU, or CUA CUA CUA) produced three different strings of amino acids. RNAs with four repeating units including UAG, UAA, or UGA, produced only dipeptides and tripeptides thus revealing that UAG, UAA, and UGA are stop codons. [25]

Their Nobel lecture was delivered on 12 December 1968. [25] Khorana was the first scientist to chemically synthesize oligonucleotides. [26] This achievement, in the 1970s, was also the world's first synthetic gene in later years, the process has become widespread. [23] Subsequent scientists referred to his research while advancing genome editing with the CRISPR/Cas9 system. [22]

Subsequent research

He extended the above to long DNA polymers using non-aqueous chemistry and assembled these into the first synthetic gene, using polymerase and ligase enzymes that link pieces of DNA together, [26] as well as methods that anticipated the invention of polymerase chain reaction (PCR). [27] These custom-designed pieces of artificial genes are widely used in biology labs for sequencing, cloning and engineering new plants and animals, and are integral to the expanding use of DNA analysis to understand gene-based human disease as well as human evolution. Khorana's invention(s) have become automated and commercialized so that anyone now can order a synthetic oligonucleotide or a gene from any of a number of companies. One merely needs to send the genetic sequence to one of the companies to receive an oligonucleotide with the desired sequence.

After the middle of the 1970s, his lab studied the biochemistry of bacteriorhodopsin, a membrane protein that converts light energy into chemical energy by creating a proton gradient. [28] Later, his lab went on to study the structurally related visual pigment known as rhodopsin. [29]

A summary of his work was provided by a former colleague at the University of Wisconsin: "Khorana was an early practitioner, and perhaps a founding father, of the field of chemical biology. He brought the power of chemical synthesis to bear on deciphering the genetic code, relying on different combinations of trinucleotides." [14] [4]

In addition to sharing the Nobel prize (while he was working at the University of Wisconsin–Madison in the U.S.), [13] Khorana was elected as Foreign Member of the Royal Society (ForMemRS) in 1978. [30] In 2007, the University of Wisconsin–Madison, the Government of India (DBT Department of Biotechnology), and the Indo-US Science and Technology Forum jointly created the Khorana Program. The mission of the Khorana Program is to build a seamless community of scientists, industrialists, and social entrepreneurs in the United States and India.

The program is focused on three objectives: [31] Providing graduate and undergraduate students with a transformative research experience, engaging partners in rural development and food security, and facilitating public-private partnerships between the U.S. and India. The Wisconsin–India Science and Technology Exchange Program (WINStep Forward, WSF) adopted administration responsibilities for the Khorana program in 2007. [32] WINStep Forward was jointly created by Drs. Aseem Ansari and Ken Shapiro at the University of Wisconsin–Madison. WINStep Forward also administers the nationally competitive S.N. Bose Programs for Indian and American students, respectively, to promote both fundamental and applied research not only in biotechnology but broadly across all STEM (science, technology, engineering, and mathematics) fields, including medicine, pharmacy, agriculture, wildlife and climate change.

In 2009, Khorana was hosted by the Khorana Program and honored at the 33rd Steenbock Symposium in Madison, Wisconsin. [19]

Other honors included the Louisa Gross Horwitz Prize from Columbia University and the Lasker Foundation Award for Basic Medical Research, both in 1969, the Golden Plate Award of the American Academy of Achievement in 1971, [33] the Willard Gibbs Medal of the Chicago section of the American Chemical Society, in 1974, the Gairdner Foundation Annual Award, in 1980 and the Paul Kayser International Award of Merit in Retina Research, in 1987. [12]

On 9 January 2018, a Google Doodle celebrated the achievements [34] of Har Gobind Khorana on what would have been his 96th birthday. [35] [36]

Khorana died on 9 November 2011, in Concord, Massachusetts, at the age of 89. His wife, Esther, and daughter, Emily Anne, had died earlier, [14] but Khorana was survived by his other two children. [10] Julia Elizabeth later wrote about her father's work as a professor: "Even while doing all this research, he was always really interested in education, in students and young people." [12]


Бейнені қараңыз: Способы клонирования организмов. 11 класс. (Қаңтар 2022).