Ақпарат

PAH генінің мутациясы

PAH генінің мутациясы


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Фенилкетонуриямен ауыратын науқаста фенилаланин гидроксилаза (PAH) генінің ДНҚ талдауы болжамды әсері амин қышқылы аспарагин қышқылын гистидинмен ауыстыру болатын ақуызды кодтау аймағындағы мутацияны анықтады. Соған қарамастан пациенттің жасушаларында мутантты ақуыз табылмады. Бұл қалай болуы мүмкін, белокты кодтау аймағындағы мутация, кім түсіндіре алады?


Сұрақтың жазылу тәсіліне келетін болсақ, менің ойымша, ең ықтимал жауап D > H аминқышқылдарын алмастыру ақуыздың қатпарлануын бұзады, осылайша ол аберрантты деп танылады және тез бұзылады.


Мұның көптеген мүмкін себептері бар, олардың ең айқын екеуі:

  1. Альтернативті қосу. Мүмкін мутация шынымен кодтау аймағында, бірақ конститутивті түрде көрсетілмеген экзонда болуы мүмкін. Нәтижесінде, осы геннен жасалған транскрипттердің көпшілігінде мутация болмайды және олардың нәтижесіндегі ақуыз да болмайды.

  2. Пост аударма өзгерістері. Мутация бар белоктар шын мәнінде өндірілуі мүмкін, бірақ гистидин посттрансляциялық модификация арқылы аспарагин қышқылына ауысады, сондықтан мутация жасуша ақуыздарында анықталмайды.


Фенилкетонурия

Фенилкетонурия (ФКУ) – фенилаланин гидроксилаза ферментінің жетіспеушілігінен туындаған тұқым қуалайтын метаболизм қатесі. Бұл ферменттің жоғалуы ақыл-ойдың артта қалуына, органдардың зақымдалуына, әдеттен тыс позаға әкеледі және ананың PKU жағдайында жүктілікті қиындатуы мүмкін.

Классикалық PKU — 12-хромосомада табылған фенилаланин гидроксилаза (PAH) генінің екі аллельіндегі мутациялардан туындаған аутосомды-рецессивті ауру. Денеде фенилаланин гидроксилаза фенилаланин амин қышқылын тирозинге, басқа амин қышқылына айналдырады. PAH генінің екі көшірмесіндегі мутациялар ферменттің белсенді емес немесе тиімділігі төмен екенін білдіреді, ал организмдегі фенилаланин концентрациясы уытты деңгейге дейін жиналуы мүмкін. Кейбір жағдайларда PAH мутациялары гиперфенилаланемия деп аталатын PKU-ның фенотиптік жеңіл түріне әкеледі. Екі ауру да PAH локусындағы әртүрлі мутациялардың нәтижесі болып табылады, егер пациент екі PAH мутациясына гетерозиготалы болса (яғни геннің әрбір көшірмесінде әртүрлі мутация бар), жеңілірек мутация басым болады.

Тышқандарда PKU түрі табылды және бұл модельдік организмдер бізге ауруды жақсырақ түсінуге және оған қарсы емдеу әдістерін табуға көмектеседі. Диетаны мұқият қадағалай отырып, PKU бар балалар қалыпты өмір сүре алады, ал аурумен ауыратын аналар сау балаларды тудыруы мүмкін.


Идиопатиялық және отбасылық өкпелік артериялық гипертензияға (PAH) генетикалық тестілеу және кеңес беру

Бұл жерде аурудың қысқаша сипаттамасы және генетикалық тестілеу берілген, ал толық ақпараттың көздері соңында келтірілген.

Отбасылық PAH дегеніміз не?

Идиопатиялық өкпелік артериялық гипертензияда (IPAH), бұрын біріншілік өкпе гипертензиясы (PPH) деп аталады, өкпедегі ұсақ артериялар арқылы қан ағымының бітелуі байқалады. Ауру әйелдерде жиі кездеседі және кез келген жаста басталуы мүмкін. IPAH пациенттерінің көпшілігінде белгілі зардап шеккен туыстары жоқ және олар бар дейді спорадикалық IPAH. Бір немесе бірнеше қан туыстарында ИПАХ бар ИПАХ науқастары бар деп айтылады отбасылық PAH (FPAH). АҚШ-та бірнеше жүз отбасында FPAH бар деп есептеледі. Кейде PAH-ның отбасылық негізі бар екенін тану қиын, өйткені ауру ұрпақты өткізіп жіберуі мүмкін, бұл пациенттің ата-анасы немесе ата-әжесі PAH болмаған кезде болады.

Отбасылық PAH не тудырады?

Көптеген отбасыларда FPAH сүйек морфогенетикалық ақуыз рецепторы 2 (BMPR2) деп аталатын ақуызды жасау үшін генетикалық бағыттағы тұқым қуалайтын өзгеріске (мутация) байланысты. BMPR2 ақуызы өкпенің кіші артерияларының қабырғаларында жасушалардың өсуін реттеуге көмектеседі. Ауруды тудыру үшін генетикалық немесе қоршаған орта факторлары да қажет, өйткені BMPR2 мутациясы бар адамдардың шамамен 20% ғана IPAH дамытады. FPAH кез келген жаста пайда болуы мүмкін және әйелдерге ерлерге қарағанда 3 есе жиі әсер етеді. Тұқым қуалайтын геморрагиялық телеангиэктазия (HHT) деп аталатын басқа генетикалық жағдайы бар отбасылардағы кейбір адамдарда ALK1 деп аталатын басқа гендегі мутацияға байланысты IPAH дамуы мүмкін. IPAH тудыратын гендер туралы білім әлі де өсуде, сондықтан басқа гендер ықпал етуі мүмкін және болашақта ашылуы мүмкін.

Ген дегеніміз не?

Гендер – ата-анадан балаға берілетін генетикалық ақпарат бірлігі. Әрбір генде денеге қажетті бір немесе бірнеше белоктарды жасау бағыттары бар. Гендер біз туралы барлық нәрсені, соның ішінде біздің денеміздің өсуі мен жұмыс істеу жолын басқарады. Барлығымыз ата-анамыздың әрқайсысынан шамамен 30 000 геннің толық жиынтығын аламыз. Сондықтан бізде әрбір ақуызды, соның ішінде BMPR2 ақуызын жасау үшін әрбір ата-анадан бір жұп гендер бар.

Отбасылық PAH қалай тұқым қуалайды?

Әрбір қалыпты адамда біздің денеміздегі әрбір жасушада BMPR2 жұп гендері бар. Бір данасы әкемізден, екіншісі анамыздан қалған. Әрбір ата-анадан мұраға алатын BMPR2 генінің көшірмесі тиын аудару сияқты кездейсоқ кездейсоқ пайда болады. Балада FPAH тудыруы үшін BMPR2 жұп гендерінің тек бір көшірмесіндегі (анасынан немесе әкесінен) мутация жеткілікті.

Қарапайым бақылау арқылы, FPAH бар отбасының қанындағы кез келген адамның өмір бойы FPAH даму қаупі шамамен 10-нан 1 немесе 10% болатынын көруге болады. Ата-анада BMPR2 генінің мутациясы болған кезде, әрбір баланың қалыпты емес генді мұра ету мүмкіндігі 50% және қалыпты генді мұра ету мүмкіндігі 50% болады. Егер бала қалыпты генді мұра етсе, онда бұл баланың қаупі жалпы популяцияға ұқсас, бұл PAH дамыту үшін миллионнан бір. Егер бала патологиялық ауру генін мұра етсе, бұл олардың FPAH дамытатынын білдірмейді. BMPR2 мутациясы бар адамның FPAH дамыту ықтималдығы шамамен 20% құрайды, дегенмен нақты қауіп әр отбасында әртүрлі болуы мүмкін. Басқаша айтқанда, BMPR2 мутациясын мұра еткен 100 адамның 80-і ешқашан IPAH дамытпайды.

Бұрыннан PAH бар науқаста генетикалық мутацияны анықтау олардың медициналық көмегіне әсер етпейді, сондықтан бұл нәтиже тек олардың отбасы үшін маңызды.

BMPR2 гені өте үлкен және онда көптеген әртүрлі мутациялар (>100) табылған. Әрбір FPAH отбасында BMPR2 бір спецификалық мутация сол отбасындағы әрбір пациентте FPAH себебі болып табылады және сол отбасындағы әрбір пациентте дәл осындай спецификалық мутация бар. Әртүрлі отбасыларда әртүрлі BMPR2 мутациялары бар. Отбасында қандай спецификалық мутация бар екенін білу маңызды, өйткені бұл отбасындағы кез келген адамға генетикалық тестілеуді жеңілдетеді. Үлкен BMPR2 генінің бір бөлігін белгілі мутацияға сынау бүкіл гендегі өзгерістерді сынаудан әлдеқайда оңай. Басқаша айтқанда, бүкіл телефон кітапшасынан қатені іздеу өте ұзақ уақытты алады және қате жіберіп алуы мүмкін, бірақ белгілі бір аттың емлесін іздеу (белгілі мутацияны тексеру) дәл және оңай.

Спорадический ИПА-ның себебі неде?

Спорадический ИПАХ-ның көпшілігінің себебі белгісіз, бірақ BMPR2 мутациялары ИПАХ пациенттерінің 10%-дан 40%-ға дейін спорадикалық IPAH тудыратыны анықталды. BMPR2 мутациялары бар IPAH пациенттерінің балалары отбасылық PAH бар адамдардың балаларымен бірдей қауіптерге ие. Әзірге спорадикалық IPAH бар адамдардың көпшілігінде анықталатын BMPR2 мутациясы жоқ.

Отбасылық PAH қаупі бар адамдар үшін қандай сынақтар бар?

Медициналық тестілеу тестілеу кезінде адамда PAH белгілерінің бар-жоғын көрсетеді. Бір қарапайым сынақ, эхокардиограмма, жүректің инвазивті емес және ауыртпалықсыз дыбыс толқыны сынағы болып табылады, ол жиі PAH скринингі үшін қолданылады. Дегенмен, ол қымбат болуы мүмкін, әрқашан дәл емес және болашақта адамның IPAH дамытатынын болжамайды.

Генетикалық тест – бұл әдетте қан үлгісінен алынған ДНҚ-ның зертханалық сынағы. Ол гендегі мутацияны іздейді. Генетикалық тестілеу нәтижелері отбасының басқа мүшесінің FPAH дамуының нақты қаупін жақсырақ анықтауы мүмкін, әсіресе бір отбасындағы PAH пациентінде BMPR2 мутациясы анықталған кезде. Генетикалық тестілеу адамда PAH белгілерінің бар-жоғын анықтамайды.

Қазіргі уақытта FPAH бар отбасылардың шамамен 80% -ында BMPR2 мутациялары анықталды. Әрбір отбасында қандай нақты мутация бар екендігі туралы ақпаратты зерттеу тобынан алуға болады. Қандай нақты BMPR2 мутациясының белгілі бір отбасында ауру тудыратыны туралы ақпарат болмаса, олардың отбасы үшін белгілі бір мутацияны анықтауға тырысу үшін сол отбасындағы FPAH бар науқастың ДНҚ-сы қажет.

Менің отбасым отбасылық PAH бойынша ғылыми жобаға қатысады. Генетикалық тест нәтижесін зерттеу зертханасынан ала аламын ба?

Заң бойынша, генетикалық мутацияларға диагностикалық тестілеуді тек арнайы лицензиясы бар клиникалық зертханалар (CLIA мақұлдау) жүргізе алады. Бұл ережелер сынамаларды талдаудың барлық кезеңдерінде қатаң сапаны бақылауды қамтамасыз етеді және сынақтың толық оқытылған қызметкерлермен орындалуын қамтамасыз етеді. Қазіргі уақытта университеттің көптеген институттық шолу кеңестері (IRB) зерттеу зертханасында алынған нәтижелерді зардап шекпеген отбасы мүшелеріне ашуға тыйым салады. Осылайша, көптеген зерттеу зертханалары нақты адамдар үшін генетикалық сынақ нәтижелерін аша алмайды, бірақ зертханалар белгілі бір отбасында BMPR2 мутациясының орны мен түрі туралы ашқан ақпаратты бере алады.

Отбасылық PAH үшін генетикалық тестті қалай алуға болады?

Күтпеген қауіптер болуы мүмкін болғандықтан, толық ақпарат алу үшін сарапшылардың (генетикалық кеңесшілер) кеңесі қажет. Адам генетикалық тестілеу туралы шешім қабылдағанға дейін кеңесшілер барлық артықшылықтарды, кемшіліктерді және шектеулерді талқылайды.

Егер отбасы зерттеуге қатысқан болса, олардың отбасында BMPR2 мутациясының анықталғанын анықтау үшін зерттеудің үйлестірушісімен немесе директорымен байланысуы мүмкін.

BMPR2 генінің мутациясы анықталған болса, зерттеуді зерттеудің үйлестірушісі генетикалық кеңес беруді ұйымдастыруға көмектесе алады. Генетика бойынша кеңесші BMPR2 мутациясына генетикалық тестілеуді қамтамасыз ететін клиникалық зертханамен байланысуға көмектеседі. Тестілеу құны әртүрлі болады. IPAH немесе FPAH бар туыстарының қан үлгісі қажет болуы мүмкін. Тестілеудің дәлдігі әдетте 99% жоғары болады.

Егер BMPR2 генінің мутациясы анықталмаса, зертхана бүкіл генді зерттеп, мутацияны табуға тырысуы мүмкін. Егер мутация табылса, бұл ақпаратты кез келген отбасы мүшесін тексеру үшін пайдалануға болады. Егер BMPR2 генінің мутациясы белгілі бір отбасында табылмаса, генетикалық тестілеу отбасының зардап шекпеген мүшелері үшін ешқандай ақпарат бермейді. Әлі табылмаған тағы бір ген осы отбасында PAH үшін жауапты болуы мүмкін.

Егер отбасы зерттеу тобына қатыспаса, олар бастапқы медициналық көмек көрсетушімен немесе генетикалық кеңесшімен байланысқысы келеді (төмендегі тізімді немесе Ұлттық генетикалық кеңесшілер қоғамының веб-сайтын қараңыз). IPAH және тестілеуді ұсынатын зертханалар туралы ақпаратты Интернеттен табуға болады.

Кімге генетикалық тексеруден өту керек?

Бұл шешім өте жеке. Кеңес бергеннен кейін әр адам өз мүддесіне не қажет екенін шешуі керек. Кейбір адамдарға төменде берілген тестілеудің «жақсы және теріс жақтарын» оқып шығу пайдалы болуы мүмкін. Бұлар әрі қарай түсіндіріледі және генетикалық кеңес кезінде егжей-тегжейлі талқыланады.

Отбасылық PAH үшін генетикалық тестілеудің кейбір ықтимал артықшылықтары

  • Адамның FPAH дамыту қаупі дәлірек, бұл олардың денсаулығына қатысты белгісіздікті азайтуы мүмкін. Олардың балаларының тәуекелді бағалаулары да дәлірек.
  • Егер адамның отбасында FPAH тудыратыны белгілі BMPR2 мутациясының жоқтығы анықталса, олар жеңілдеп қалуы мүмкін және FPAH үшін медициналық скринингті қауіпсіз түрде тоқтата алады.
  • Нәтижені білу адамның отбасын немесе қаржылық шешімдерін жоспарлауға көмектесуі мүмкін.

Отбасылық PAH үшін генетикалық тестілеудің кейбір мүмкін кемшіліктері немесе шектеулері

  • Егер адамның отбасында FPAH тудыратын BMPR2 мутациясы болса, олар әлі де FPAH дамытатынын немесе қашан дамытатынын білмейді. Медициналық скрининг бойынша ұсыныстар генетикалық тестілеуден өткенге дейін бірдей.
  • Егер адамда отбасылық BMPR2 мутациясы болса, олар алаңдаушылық, депрессия немесе ренжітуді сезінуі мүмкін.
  • Адамның денсаулығы туралы жазбасы отбасылық BMPR2 мутациясын мұра еткенін көрсетсе, өмірді немесе денсаулықты сақтандыруды сатып алуда қиындықтар туындауы мүмкін.
  • Адам өзін кінәлі сезінуі мүмкін, өйткені олар отбасылық BMPR2 мутациясын мұра етпеді және аурудан құтылды, ал туыстары FPAH-дан зардап шекті.
  • Кейбір жағдайларда генетикалық тест нәтижелері ашулану, реніш немесе отбасылық қарым-қатынасқа әсер ететін басқа да проблемаларды тудыруы мүмкін.

Балалар FPAH немесе IPAH үшін генетикалық тестілеуден өтуі мүмкін бе?

18 жасқа толмаған балаларда генетикалық тестілеу елеулі этикалық мәселелер тудырады, өйткені олар заңды түрде саналы шешім қабылдай алмайды. Дегенмен, генетикалық тестілеу олардың болашағына қатты әсер етуі мүмкін. Мысалы, генетикалық тестілеудің нәтижелері баланың өзін-өзі имиджін және болашақ ұмтылыстарын өзгертуі мүмкін. Бұл бала мен ата-ана арасындағы қарым-қатынасқа да әсер етуі мүмкін.

Осы себептерге байланысты көптеген сарапшылар нәтижелер айтарлықтай медициналық пайда әкелетін жағдайларды қоспағанда, балалық шақта генетикалық тестілеуден аулақ болуды ұсынады. Американдық педиатрия академиясы да, американдық адам генетикасы қоғамы да этикалық мәселелерге қатысты мәлімдемелер жариялады.

IPAH-те балалық шақта генетикалық тестілеу ұзақ мерзімді медициналық нәтижені жақсартатынына ешқандай дәлел жоқ. Егер адам тестілеудің өз баласы үшін пайдалы болатынын қатты сезінсе, олар генетикалық кеңесшімен және балалар өкпе гипертензиясының дәрігерімен немесе басқа сарапшымен өз мәселелерін талқылағысы келуі мүмкін.

Генетикалық тестілеу адам өмірінің медициналық, әлеуметтік және эмоционалдық аспектілеріне көптеген маңызды әсер етеді. Осы себепті тестілеуге дейін және одан кейін кәсіби кеңес беру өте маңызды және тестілеу орталықтары талап етеді.

Қазіргі уақытта бірнеше орталықтар ғана өкпе артериялық гипертензиясы бар науқастарға және олардың отбасыларына генетикалық тестілеу мен кәсіби кеңес береді. Қазіргі уақытта бұл орталықтарға мыналар кіреді:

  • Колумбия университеті
  • LDS ауруханасы және Юта университеті
  • Вандербилт университеті

Генетикалық тестілеу және PAH туралы қосымша ақпарат алу үшін мыналарға хабарласуға болады:

Колумбия университеті
Венди Чунг, MD, PhD, директор
212-851-5313
[email protected]

LDS ауруханасы / Юта университеті
Джанет Уильямс, М.С.
Генетикалық кеңесші
801-408-5057
[email protected]

Вандербилт университеті
Вики Ханниг, М.С.
Генетика бойынша кеңесші
615-322-7601
[email protected]

Тестілеуден бұрын кеңес алу ұсынылады және жиі қажет. Тестілеуді келесі клиникалық зертханаларда алуға болады:

Колумбия университетінің молекулалық биология зертханасы
Нью-Йорк, Нью-Йорк
Махеш М Мансухани, MD, директор
212-305-2546

LDS ауруханасы
Солт-Лейк-Сити, Юта
Джон Карлквист, PhD, директор
801-408-1028

Вандербилт университетінің молекулалық-генетика зертханасы
Нэшвилл, ТН
Синди Вненчак-Джонс, PhD, директор
615-343-9074

GINA-генетикалық ақпаратты кемсітпеу туралы заң

2008 жылғы 21 мамырда заңға қол қойылды және жұмыс берушілер мен сақтандыру компанияларына генетикалық ақпарат негізінде жұмысқа орналасудан, жоғарылатудан және/немесе денсаулықты қорғаудан бас тартуға тыйым салады.

H. R. 493 мәліметтерін Конгресс кітапханасының веб-сайтынан табуға болады. Томас түймесін басып, шот нөмірін енгізіңіз.

Саяси мәлімдемелер:

ASHG/ACMG саясатының мәлімдемесі. Балалар мен жасөспірімдердегі генетикалық тестілеудің этикалық, құқықтық және психоәлеуметтік салдары. Am J Hum Genet 199557: 1233-1241.

Американдық педиатрия академиясы биоэтика комитеті. Саясат туралы мәлімдеме: педиатриядағы генетикалық тестілеудің этикалық мәселелері. Педиатрия 2001107:1451-1455.

Анықтамалар мен ресурстар:


GeneTests веб-сайты:
Бұл сайтта көптеген генетикалық жағдайлардың қысқаша мазмұны бар, соның ішінде PPH. Сондай-ақ, онда генетикалық клиникалар мен зертханалар үшін әр зертхана орындайтын сынақтар тізіміне сілтемелер бар байланыс ақпараты бар.

Ұлттық генетикалық кеңесшілер қоғамының веб-сайты: Бұл сайт аймағыңыздағы генетикалық кеңесшілерге арналған байланыс ақпаратын береді.

Генетикалық тестілеу тізілімі: Ұлттық денсаулық сақтау институтының бұл сайты провайдерлер ұсынған генетикалық сынақтар туралы толық ақпаратты ұсынады.


Фенилкетонурия

Фенилкетонурия (PKU) - организмдегі фенилаланин деңгейін жоғарылататын генетикалық метаболикалық бұзылыс. Фенилаланин - белоктардың құрылыс блоктарының (амин қышқылдарының) бірі. Адамдар фенилаланинді жасай алмайды, бірақ бұл біз жейтін тағамдардың табиғи бөлігі. Дегенмен, адамдарға олар жейтін барлық фенилаланин қажет емес, сондықтан дене қосымша фенилаланинді басқа зиянсыз амин қышқылына, тирозинге айналдырады. PKU бар адамдар тирозинге айналдыру үшін қосымша фенилаланинді дұрыс бұза алмайды. Бұл фенилаланиннің адамның қанында, зәрінде және денесінде жиналатынын білдіреді. Егер PKU емделмесе, фенилаланин денеде зиянды деңгейге дейін жиналуы мүмкін. [1] [2] [3]

PKU жеңілден ауырға дейін өзгереді. Ең ауыр түрі классикалық PKU деп аталады. Емдеусіз классикалық PKU бар балаларда тұрақты интеллектуалдық бұзылулар дамиды. Ашық тері мен шаш, құрысулар, дамудың кешігуі, мінез-құлық проблемалары және психикалық бұзылулар да жиі кездеседі. Кейде «жеңіл PKU», «вариантты PKU» және «PKU емес гиперфенилаланинемия» деп аталатын жеңілірек формаларда мидың зақымдану қаупі азырақ болады. PKU бар және фенилаланинмен шектелген диетаны енді ұстанбайтын аналардың ақыл-ойы бұзылған балаларды туылу қаупі жоғары, өйткені олардың балалары туылғанға дейін фенилаланиннің өте жоғары деңгейіне ұшырауы мүмкін. [1] [2] [3]

Көптеген жағдайларда PKU өзгерістерден (патогендік нұсқалар, мутациялар деп те аталады) туындайды PAH ген. Тұқым қуалаушылық аутосомды-рецессивті. [1] [2] PKU қарапайым қан сынағы арқылы анықталуы мүмкін және емдеуге болатындықтан, PKU жаңа туған нәресте скринингінің бөлігі болып табылады. PKU емдеу әдетте мұқият бақыланатын фенилаланинмен шектелген диетаны қамтиды. Кейбір PKU бар балалар мен ересектерге фенилаланинді төмен диетамен біріктірілген сапоптерин препараты көмектесуі мүмкін. [1] [2] [3] Емдеуге қарамастан фенилаланин деңгейі жоғары ересектерге пегвалиаза препараты көмектесуі мүмкін. [3]


Қолдау және қорғау топтары басқа пациенттермен және отбасылармен байланысуға көмектеседі және олар құнды қызметтерді ұсына алады. Көбісі емделушіге бағытталған ақпаратты дамытады және жақсырақ емдеу мен мүмкін емдеуге арналған зерттеулердің қозғаушы күші болып табылады. Олар сізді зерттеулерге, ресурстарға және қызметтерге бағыттай алады. Көптеген ұйымдарда медициналық кеңесші ретінде қызмет ететін немесе дәрігерлер/емханалардың тізімін беретін сарапшылар бар. Топтың веб-сайтына кіріңіз немесе олар ұсынатын қызметтер туралы білу үшін оларға хабарласыңыз.Бұл тізімге енгізу GARD мақұлдауы емес.

Бұл ауруды қолдайтын ұйымдар

Әлеуметтік желі сайттары

Жалпы қолдау көрсететін ұйымдар


Аннотация

Өкпенің артериялық гипертензиясы (PAH) - аурудың патогенезі туралы генетикалық және соған байланысты патофизиологиялық ақпараттың үнемі кеңеюі бар прогрессивті және өлімге әкелетін ауру. Қазіргі уақытта көптеген гендік мутациялар сипатталған, соның ішінде 2 типті сүйек морфогенді ақуыз рецепторын кодтайтын гендегі мутациялар (BMPR2) және байланысты гендер. Соңғы жетілдірілген гендік секвенирлеу әдістері PAH отбасылық формалары бар және жоқ адамдар арасында мутациялары бар қосымша гендердің ашылуына ықпал етті.CAV1, KCNK3, EIF2AK4). PAH-тің төмендеуі, өзгермелі экспрессивтілігі және әйелдердің басым болуы генетикалық, геномдық және басқа факторлар аурудың көрінісін өзгертетінін көрсетеді. Бұл көп қырлы вариациялар кең таралған генетикалық нұсқаларды және эпигенетикалық процестерді қоса алғанда, бірақ олармен шектелмей, осы саладағы белсенді зерттеу аймағы болып табылады және жақын болашақта фармакологиялық араласу үшін жаңа мүмкіндіктерді қамтамасыз етуі мүмкін. Олар сонымен қатар PAH-пен байланысты көптеген биологиялық вариацияларды біріктіру үшін жүйеге бағытталған көп деңгейлі тәсілдің қажеттілігін көрсетеді. Сайып келгенде, PAH-ге қатысты генетикалық факторларды терең түсіну пациентке және отбасына осы ауыр ауру туралы кеңес беруді жақсартуға мүмкіндік береді.

Кіріспе

Өкпе гипертензиясы (PH) - әртүрлі себептерге байланысты өкпе тамырлар жүйесіндегі қысымның орынсыз жоғарылауы. РН-ның бір кіші түрі - өкпелік артериялық гипертензия (PAH). PAH - өкпе тамырларының ауыр ауруы, ол патологиялық түрде прогрессивті неоинтимальды пролиферациямен, тегіс бұлшықет жасушаларының гипертрофиясымен және ең кішкентай өкпе артерияларының окклюзиялық тамырлы зақымдануына әкелетін қоршаған адвентициялық кеңеюмен сипатталады. 1 PAH классификациясының әртүрлі әдістері болғанымен, ең көп қолданылатыны бүкіл әлемде қабылданған және жақында жаңартылған клиникалық жіктеу жүйесі болып табылады. 2 Бұл схемада 1-топ PAH тұқым қуалайтын (HPAH, бұрынғы отбасылық PAH), идиопатиялық (IPAH) және әртүрлі басқа жүйелік аурулармен немесе есірткі/токсин әсерлерімен байланысты PAH қамтитын аурулардың ішкі топтарына бөлінеді.

Соңғы 25 жылдағы терапиядағы жетістіктерге қарамастан, PAH өмір сүру ұзақтығы айтарлықтай төмендеген инциденттер үшін жойқын ауру болып қала береді. 3 Өкінішке орай, бүгінгі күнге дейін сыналған ешбір ем PAH-ті қалпына келтіру немесе емдеу мүмкіндігін көрсетпеді. Жаңа терапевтік дамуға жәрдемдесу үшін біздің патофизиологиялық білімімізді тереңдету қажет. 3–8

Дрездейл және басқалар 9,10 1950-ші жылдардың басында оқшауланған немесе отбасында пайда болуы мүмкін ауру ретінде оның бастапқы сипаттамасынан (бастапқы PH ретінде) PAH-ты көтеретін молекулалық және генетикалық факторлар туралы көп нәрсе білді. 1990 және 2000 жылдардың басындағы жұмыс сүйек морфогенді ақуыз рецепторларының 2 типті (BMPR2) сигнализациясы сирек кездесетін нұсқалар (мутациялар) арқылы PAH дамуының негізгі тұқым қуалайтын қауіп факторы болып табылатынын анықтауға әкелді. BMPR2 ген. 11,12 2000 жылдан бастап BMPR2 сигнализациясына қатысты басқа гендердегі мутациялар табылды (мысалы, ALK1, ҚАЗ және SMAD9) және аурудың экспрессиясының генетикалық және эпигенетикалық модификаторларын анықтауда прогреске қол жеткізілді (1-кесте). Жақында PAH патогенезіне қатысты жаңа геномдық механизмдерді ашу үшін озық генетикалық және геномдық әдістерді қолдануда жарылыс болды, бұл осы жойқын аурудың генетикалық және молекулалық негіздерін зерттеудің қызықты уақытына айналды. PAH генетикасына тән ағымдағы концепциялар, сондай-ақ жүргізіліп жатқан барлау бағыттары осы шолудың тақырыбы болады.

1-кесте. Сирек нұсқалар (мутациялар) PAH-пен байланысады

Аутосомды-доминантты отбасылық аурумен байланысты барлық гендер қоспағанда EIF2AK4, ол аутосомды-рецессивті PVOD және PCH-мен байланысты. HHT тұқым қуалайтын геморрагиялық телеангиэктазияны көрсетеді IPAH, идиопатиялық өкпе артериялық гипертензиясы PAH, өкпе артериялық гипертензия PCH, өкпе капиллярлық гемангиоматоз ПВОД, өкпенің венокклюзиялық ауруы және TGF-β, өсу факторы-β трансформациясы.

PAH генетикасына қатысты эпидемиологиялық факторлар

PH – жүректің оң жақ катетеризациясы арқылы инвазивті гемодинамикалық бағалау арқылы анықталған өкпе қан тамырлары қысымының жоғарылауы. PH кіші тобы (1-топ), PAH өкпе тамырларының қысымын жоғарылататын басқа жағдайлар, мысалы, жүректің сол жақты ауруы, өкпенің гипоксиялық аурулары, өкпе эмболиясы және PH-мен байланысты басқа да жағдайлар. 13,14 PAH бар адамдар, егер олар келесі критерийлердің кез келгеніне сәйкес келсе, HPAH классификациясына сәйкес келеді: (1) 2 немесе одан да көп адамдарда PAH құжатталғаны белгілі отбасына жатады (2) сирек нұсқаға ие (сондай-ақ мутация ретінде белгілі) PAH-пен тығыз байланыста болатын генде (мысалы, BMPR2). 15 Бұл критерийлер HPAH бар көптеген субъектілерде белгілі отбасы тарихы жоқ екенін мойындайды. Соңғы 15 жыл ішінде PAH генетикасындағы маңызды жетістіктер бұл тануға түрткі болды, өйткені біз қазір белгілі отбасылық PAH тарихы жоқ субъектілерде олардың ұрпақтарына берілуі мүмкін тұқым қуалайтын ауру болуы мүмкін екенін білеміз. Бұл субъектілер басқа жағдайда IPAH деп есептелетін еді, бірақ белгілі PAH-ассоциацияланған гендердің ену қабілетінің төмендеуіне байланысты, сондай-ақ тұжырымдама кезінде геннің жаңа өзгерістері болғандықтан, бұл субъектілерде бұрын танылмаған тұқым қуалайтын ауру бар. 16 IPAH отбасылық PAH-ға қарағанда әлдеқайда кең таралғандықтан, тұқым қуалайтын PAH бар пациенттердің ең көп саны шын мәнінде тұқым қуалайтын ауруы бар ИПАХ дұрыс жіктелмеген. 17

Отбасылық PAH және IPAH гистопатологиялық жағынан бірдей болғанымен, аурудың клиникалық көрінісі мен прогрессиясына әсер ететін кіші типтер арасында айырмашылықтар бар. 18 Мутация күйіне тәуелсіз, тарихи және соңғы деректер ИПА инциденттік жағдайлары отбасылық PAH қарағанда ≈15 есе жиірек деген тұжырымды қолдайды. 17,19 Отбасылық PAH және IPAH жағдайлары арасында гемодинамика ұқсас болғанымен, BMPR2 мутация PAH пациенттері ≈10 жыл бұрын диагноз қойылады және мутациясыз PAH пациенттеріне қарағанда, ИПАХ пациенттері де, сондай-ақ өледі. BMPR2 PAH бар мутация тасымалдаушылардың жедел вазодилататорлық сынақтарға жауап беру ықтималдығы өте төмен. 20–22 Алайда, HPAH активин А рецепторының II типті киназа-1 мутациясымен байланысты.ACVRL1 немесе ALK1), трансформацияланатын өсу факторы-β (TGF-β) рецепторлар тобына жататын рецепторлардың жақында француздық зерттеу ұсынғандай, одан да ауыр ауруы бар. Атап айтқанда, олар мұны тапты ALK1 мутацияланған PAH пациенттерімен салыстырғанда өмір сүру ұзақтығы нашар болды BMPR2 PAH бар тасымалдаушылармен және тасымалдаушы еместермен. 23

Отбасындағы PAH

HPAH-пен байланысты генетикалық мутациялар ашылғанға дейін, HPAH аутосомды-доминантты жолмен берілетін отбасылық ауру екені байқалды. Бұл зардап шеккен отбасылардағы негізгі әсер ететін гендік мутация үшін гетерозиготалылық екенін көрсетеді. Бірақ аутосомды-доминантты ауру болса да, ол ену қабілетінің төмендеуіне байланысты қауіп тобындағы барлық субъектілерге әсер етпейді. 24,25 Бұған қоса, тәуекелге ұшыраған отбасылардың ішінде де, арасында да ену деңгейі әртүрлі. Бұл төмендетілген еніп кету HPAH тудыруы үшін PAH-спецификалық ген мутациясының болуы қажет, бірақ өздігінен жеткіліксіз екенін көрсетеді. 26 Өткізу қабілетін төмендететін механизмдер белгісіз болғанымен, зерттеушілердің көпшілігі бұл қосымша генетикалық немесе қоршаған орта немесе екі фактор да аурудың көрінісін өзгертеді және тек патогенезге ғана емес, сонымен қатар әлеуетті терапиялық мақсаттарға да анықтама бере алады деп келіседі. 27 Ларкин және басқалар 28 жақында Вандербилт университетінде біздің HPAH зерттеу тобын талдап, отбасылық PAH жалпы енуін 27% деп есептеді. Дегенмен, қосымша факторлар аурудың енуін (жынысы сияқты) өзгертеді деген гипотезаға сәйкес, әйелдердің енуі 42%, ал еркектердің енуі тек 14% болды.

HPAH-тың бірнеше қосымша қызықты ерекшеліктері осы аурудың ауыспалы экспрессивтілігін көрсетеді. Диагноздың орташа жасы 30-жылдардың ортасы болғанымен, ол өте өзгермелі. 21 Субъектілерге ерте балалық шақтан бастап 70 жастан асқанға дейін өмір сүру барысында іс жүзінде кез келген жаста диагноз қойылған. Сонымен қатар, PAH тұқым қуалайтын түріне тән ерекшелік болмаса да, HPAH ерлер мен әйелдерге бірдей әсер етпейді (≈2:1 әйел: ерлердің қатынасы). 15,28

Дегенмен, жақында HPAH-ке дәстүрлі түрде жатқызылған бір ерекшелік жоққа шығарылғанын атап өткен жөн. Кейінгі ұрпақтарда аурудың бірте-бірте ерте басталу жасымен сипатталатын генетикалық күту биологиялық түсіндірменің жоқтығына қарамастан, PAH отбасыларында пайда болады деп күдіктенді. 29–32 Алайда, анықтаудың біркелкі болуына байланысты, генетикалық болжамды дәлелдеуге бірнеше онжылдық бақылаудың пайдасынсыз қол жеткізу қиын. Осылайша, біздің зерттеу тобымыздағы құбылысты мұқият көрсету мақсатында, Ларкин және басқалар 33 жақында генетикалық күту үшін HPAH отбасыларын талдау үшін туған күнді шектеу арқылы сызықтық аралас әсерлер модельдерін және шектеулі уақытты қысқарту бағытын орындады. Бұл аналитикалық әдіс генетикалық болжамды растайтын ешқандай дәлел келтірмеді. Анасы мен қызында PAH-ны бір уақытта емдеген көптеген дәрігерлер бұл жағдайға таң қалды, бірақ қыздың ұрпағында PAH-тың кеш басталуын байқау көптеген ондаған жылдар бойы бақылауды қажет етеді. Осылайша, қазіргі дәлелдер HPAH-те генетикалық болжамды қолдамайды.

Ашылуы BMPR2 Отбасылық PAH-дағы гендік мутациялар

Отбасылық PAH сирек кездесетінін ескере отырып, генетикалық зерттеулер бірлескен зерттеу күштері мен фенотиптік және биоүлгі деректерін қолдауға арналған орталықтандырылған орталықтардан үлкен пайда әкеледі. 1990 жылдары, келесі ұрпақ секвенциясы пайда болғанға дейін, тәуелсіз жұмыс істейтін 2 топ HPAH жағдайларының көпшілігіне бір ген жауапты деген гипотезаны тексеру үшін аңшылық жасады. Олар бүгінгі күнге дейін бар бірлескен келісімдер мен үлкен биорепозиторийлердің арқасында ішінара сәтті болды. Доктор Джейн Морзе Колумбия университетінің тергеушілерінің күш-жігерін басқарды, ал Халықаралық PH консорциумын (Вандербилт университетінің, Лестер университетінің, Цинциннати балалар ауруханасының медициналық орталығы мен Индиана университетінің зерттеушілерінен құралған бірлескен ұйым) доктор Ричард С. Трембат, Раджив басқарды. Д.Мачадо, Уильям Си Николс және Джеймс Э.Лойд. Екі топ бастапқыда 2q31-33 хромосомасын зерттелетін отбасылардағы PAH-пен байланысты аймақ ретінде анықтау үшін қысқа тандемді қайталауларға және басқа микросателлиттік маркерлерге сілтеме талдауын қолданды. 34,35 Бірнеше жыл ішінде екі топ анықталды BMPR2 әртүрлі тәсілдер арқылы қызығушылық гені ретінде. Сол кездегі тергеушілерге белгісіз, қатты зардап шеккен бір PAH отбасы генетикалық тұрғыдан өте ақпараттандырылған және бұл жеке отбасы екі топтағы 2q32-мен байланысын көрсететін түпнұсқа дәлелдер келтірді. 36,37 Осы алғашқы есептерден бастап, BMPR2 гендік мутациялар отбасылық PAH-мен нақты байланысты болды, қазір 400-ден астам әртүрлі мутациялар. BMPR2 тікелей секвенирлеу, балқу қисығын талдау, DHPLC (жоғары қысымды сұйықтық хроматографиясын денатурациялау), Southern blotting және мультиплексті байланыстыруға тәуелді зондты күшейту сияқты әртүрлі әдістерді қолдану. 16 Нақты BMPR2 жалпы популяциядағы мутация жылдамдығы белгісіз, бірақ өте төмен деп саналады. 38 Қазіргі уақытта мутациялардың болатыны белгілі BMPR2 HPAH жағдайларының ≈75%-ына жауапты. -ның ашылуы таңқаларлық емес BMPR2 рецепторлардың TGF-β суперфамилиясының өзектілігін және PAH-ке сигнал беруді атап өтті. Сондай-ақ отбасылық PAH жағдайларының аз пайызы TGF-β отбасының басқа рецепторлары мүшелерінің мутацияларына немесе байланысты төменгі ағынды сигнал беретін ақуыздарға жатады (мысалы, ACVRL1/ALK1, эндоглин/ҚАЗ, және SMAD9). Белгілі мутациялар үшін теріс болып табылатын HPAH қалған жағдайларында TGF-β жолындағы гендерде әлі анықталмаған өзгерістер болуы мүмкін, мысалы: SMAD9Жақында баламалы жаңа ген мутацияларына назар аударылды. 39

Жоғарыда айтылғандай, TGF-β суперотбасымен тікелей байланысты 2 қосымша локустағы мутациялар отбасыларда PAH фенотипін тудыруы мүмкін, дегенмен PAH-тың бұл түрі тұқым қуалайтын геморрагиялық телеангиэктазия (HHT) деп аталатын кеңірек тұқым қуалайтын аурумен бірге нәтиже береді. Шырышты-тері телеангиэктазияларымен, қайталанатын мұрыннан қан кетумен және асқазан-ішектен қан кетумен сипатталатын тамырлы дисплазия, HHT сонымен қатар 1-топ PAH-мен байланысты. HHT пациенттерінде өкпе, бауыр және церебральды қан айналымының артериовенозды ақауларын қоса алғанда, басқа тамырлық ауытқулар бар, бірақ бұл нәтижелер сырлы болуы немесе кейінірек дамуы мүмкін. TGF-β сигнал беретін жоғарғы отбасылық рецепторлар кешенінің қосымша мүшелеріне арналған гендер, активин рецепторы тәрізді киназа 1 (ALK1) 12 хромосомада және эндоглинде (ҚАЗ) 9-хромосомада HHT және HHT-ассоциацияланған PAH-пен күшті байланысатыны белгілі. 40-43 HPAH бар емделушілерде TGF-β сигналдық жолындағы мутациялар үшін локустардың гетерогенділігі бұл жолдағы ақаулар PAH-ке әкелетін өкпе тамырларының ауруына ықпал етеді деп болжайды. Бұл таңқаларлық емес, өйткені белок рецепторлары коактиваторлардың Smad отбасы арқылы, сондай-ақ сигнал берудің кейбір канондық емес жолдары арқылы жасуша ішінде сигнал шығарды. 44,45 Нақты механизмдер әлі нақтыланбағанымен, рецепторлардың TGF-β суперфамилясы үшін сигнал берудің әртүрлі сатыларындағы вариациялар ұқсас фенотиптік өрнекке әкелуі мүмкін және бұл сигналды жақсы түсіну түсінуді жақсартатыны анық. HPAH.

BMPR2 PH басқа нысандарында

ашылуы BMPR2 отбасылардағы PAH-пен байланысты гендік мутациялар PAH-тегі сүйек морфогенетикалық ақуызының (BMP)/TGFβ сигналдық осінің ықтимал маңыздылығын көрсетті. Жанұялардағы PAH және IPAH арасындағы ұқсастықтарды ескере отырып, әрине, тергеушілер IPAH жағдайларын дереу тексерді. BMPR2 отбасылық бірлестіктің жоқтығына қарамастан ген. Бұл болмауы көптеген жолдармен түсіндірілуі мүмкін, соның ішінде басқа отбасы мүшелерінде жоқ де-ново гермлиндік мутациялар, ену қабілетінің төмендеуі, отбасылық тарих үшін деректердің жеткіліксіздігі және қате диагноз. 46 Күтілгендей, IPAH жағдайларының бір бөлігін анықтауға болады BMPR2 гендік мутациялар, ал хабарланған пропорциялар өзгермелі, жалпы алғанда IPAH пациенттерінің ≈15% (6–40%) шын мәнінде HPAH бар BMPR2 гендік мутация. 46–49

Нағыз идиопатиялық PAH отбасылық PAH қарағанда 10-15 есе жиі кездесетінін ескерсек, науқастардың басым көпшілігінде BMPR2-ассоциацияланған PAH шын мәнінде басқа жағдайда IPAH ретінде жіктелетін нәрсеге ие. Бұл тармақ IPAH жағдайларының айтарлықтай пайызында генетикалық кеңес беру және отбасы скринингі қарастырылуы керек тұқым қуалайтын ауру бар деген түсінікті көрсетеді. PAH отбасыларында қауіп әдетте айқын және басқа мүшелер біледі, бірақ теріс отбасылық тарихы бар PAH пациенттерінің олардың отбасы мүшелеріне қауіп төндіретініне күмәндануға клиникалық негіз жоқ.

Мутациялар BMPR2 және басқа TGFβ байланысты гендер кейбір ерекшеліктерді қоспағанда, PH басқа себептерінде дәйекті түрде табылған жоқ. Мысалы, өкпенің вено-окклюзиялық ауруы (ПВОД) бар науқастардың барлығында емес, кейбіреулерінде тамыр өзгерістері ұсақ өкпе веналары мен венулаларға да әсер ететін PH сирек түрі, гермлиндік мутацияларға ие. BMPR2. 48,50,51 анықтау BMPR2 PVOD жағдайларындағы мутациялар а BMPR2 мутация, яғни бір генетикалық локустағы әртүрлі аллельді мутациялар әртүрлі аурудың фенотиптерін тудыруы мүмкін. Балама ретінде, PAH және PVOD аурудың бір спектрінің әртүрлі ұштарын білдіруі мүмкін, негізгі аурудың өкпе қан тамырларына (артерияға қарсы вена) қосымша генетикалық немесе қоршаған орта немесе екі модификатор әсер етеді. 50

BMPR2 Сондай-ақ фенфлурамин мен декфенфлураминді қоса, тәбетті басатын заттардың әсерінен PAH бар стимуляторлармен байланысты PAH бар субъектілерде гендік мутациялар анықталды. 52,53 Нақты механизм түсініксіз болып қала берсе де, бұл препараттар генетикалық тұрғыдан сезімтал адамдарда PAH ілгерілету үшін экологиялық триггерлер ретінде қызмет етуі мүмкін. Сезімталдықтың немесе қорғаныстың жеке факторлары, салыстырмалы түрде жоғары әсер ету жылдамдығына қарамастан, стимуляторларды пайдаланушылар арасында PAH даму қарқыны айтарлықтай төмен екенін ескере отырып, өте орынды (мысалы, фенфлураминге ұшыраған 10 000 адамға ≈1 жағдай). 18 Франциядағы зерттеушілер анықталатын BMPR2 генінің мутациясына оң стимулятормен байланысты PAH бар субъектілердің 10%-ға жуығын сипаттады, алайда бұл пропорция спорадикалық IPAH жағдайларындағыға ұқсас болғандықтан, бұл гендік мутацияның болуы гендік мутациямен байланысты емес дегенді білдіруі мүмкін. есірткінің әсері. Бірақ фенфлураминнің әсерімен байланысты PAH бар басқа пациенттермен салыстырғанда, атап өткен жөн. BMPR2 мутация тасымалдаушылары ауруды фенфлураминге әсер етудің айтарлықтай қысқа аралығынан кейін білдірді. 54

PH бар қосымша топтардың жаһандық жарияланған бағасы жоқ болса да, BMPR2 белгілі бір дәрежеде туа біткен жүрек ақауларымен байланысты PAH зерттелген. Мутациялар жалпы популяциядан жоғары пропорцияларда болғанымен, бар субъектілердің саны BMPR2 мутациялар аз болып қалады. Атап айтқанда, Робертс және басқалар 55 анықтады BMPR2 106 баланың (n = 66) және ересектердің (n = 40) 6% -ында вариациялар байқалды, ал тай когортасында Limsuwan және басқалар 56 30 баланың арасында BMPR2 мутациясын таппаған. Дегенмен, қазіргі уақытта қолданылып жүрген кеңейтілген генетикалық талдауларды пайдалана отырып, қосымша мутацияларды ашуы мүмкін үлкен гендердің жойылуын және қайталануын жан-жақты бағалауды қамтитын зерттеулер жарияланған жоқ. 57 Жүрек-қантамыр жүйесінің эмбриологиялық дамуына BMP жолының маңыздылығын ескере отырып, CDH дамуы үшін де, сонымен қатар байланысты PAH үшін де қосымша зерттеулер қажет. Бұл, әсіресе, атриовентрикулярлық канал немесе септация ақауларына қатысты болуы мүмкін. 58

Басқа PH топтары үшін мутациялардың жоғары пропорцияда табылуы екіталай. Мысалға, BMPR2 мутациялар склеродермиямен байланысты ПАГ бар емделушілерде немесе АҚТҚ бар АИТВ жұқтырған емделушілерде шағын есептерде табылған жоқ. 59,60 № BMPR2 созылмалы тромбоэмболиялық PAH бар 103 пациенттің үлкен сериясында мутациялар анықталды. 61

Молекулярлық радиациялық а BMPR2 Гендік мутация

Бірлестігі кезінде BMPR2 HPAH бар гендік мутациялар генетикалық эпидемиологияға байланысты бұдан былай даулы емес, таңқаларлық, біз әлі күнге дейін неге екенін түсінбейміз. BMPR2 мутация тасымалдаушылары PAH дамытады. Мысалға, BMPR2 мутациялардың барлығы жасуша сигналына бірдей әсер етпейді, тіпті өкпе тамырларының ішінде де жасушаға тән вариациялар бар. Өкпе тамырларының эндотелий жасушалары BMPR2 мутациясының қатысуымен дисфункционалды және апоптозға сезімтал болып көрінеді. 62 Алайда, BMPR2 мутациялары бар өкпе тамырларының тегіс бұлшықет жасушаларында өсуді басудың сәтсіздігі бар. Бұл пролиферативті фенотиптің а BMPR2 мутация немесе дисфункциялы эндотелий жасушалары арқылы тегіс бұлшықет жасушаларының көбеюіне ықпал ететін өсу факторларының жоғарылауымен байланысты. 63

Сонымен қатар, мутацияның әрбір түрі әртүрлі және не гаплоин жеткіліксіздігі (белок өнімі мен функциясы жеткіліксіз) немесе басым теріс (ашық зиянды ақуыз әрекеті) әсерін тудыруы мүмкін. Айта кету керек, Bmpr2 нокаут кеміргіштерінде PAH дамымайды, ал кеміргіштерге түскен басым теріс Bmpr2 мутациялары аурудың өтуін жақсарту үшін қосымша қорлауды қажет етті. 64 Кейбір деректер басым теріс мутациялар фенотипті ауырлатады деп болжаса да, қайталанатын фенотиптік айырмашылықтардың пайда болатын-болмайтыны белгісіз. 21,65 функционалдық әсерін шынайы және жан-жақты түсіну BMPR2 Өкпе тамырларындағы (және басқа гендік) мутациялар әлі де жалғасуда.

Әзірге BMPR2 HPAH-пен байланысты мутациялар ұрық сызығы болып табылады және осылайша дененің әрбір жасушасында болады, өкпе қантамырлары клиникалық түрде айқын патологияның орны болып табылады - бұл неліктен тек өкпе қантамырлары қалыпты емес деген көптен келе жатқан сұрақты тудырды? Бұл сұрақ түсініксіз болып қала береді, өйткені қан тамырларының немесе басқа да анатомиялық ауытқулармен байланысты тұрақты түрде хабарланған анық. BMPR2 гендік мутация. Бұл қолқа аневризмасы бар SMAD3 мутациялары, сондай-ақ фибриллин 1 және марфан синдромымен байланысты цитокиндердің TGFβ тобының шамадан тыс сигналын тудыратын басқа да мутациялар сияқты басқа TGFβ суперфамилия гендерінің мутацияларымен байланысты белгілі жүйелі тамырлық зақымдануларды ескере отырып, бұл әсіресе таң қалдырады. . 66,67 Мүмкіндіктердің бірі - канондық TGFβ сигнализациясы мен BMP сигналы арасындағы болжамды тепе-теңдіктің бұзылуына өкпеге тән сезімталдықтың болуы - қалыпты немесе күшейтілген TGFβ сигналы жағдайында PAH патогенезіне ықпал ететін BMP сигналының төмендеуі. 68,69

Дегенмен, қазіргі уақытта өкпе қан айналымы бастапқы патологияның орны болып табылатынын болжайтын мәліметтердің саны өсуде. BMPR2 мутация тасымалдаушыларында PAH патогенезіне немесе қарыншалық стресске дезадаптацияға ықпал етуі мүмкін жүйелік бұзылулар бар. Мысалы, инсулинге төзімділік PAH басым теріс тышқан үлгісінде Bmpr2 мутациясының ерте ерекшелігі ретінде бар және сол тышқандарда триглицеридтердің көп тұндыруымен оң жақ қарыншаның гипертрофиясы бұзылған. 70,71 Осыған сәйкес адам пациенттерінде Хемнес және басқалар 71 жақында оң жақ қарыншаның липидті тұндыруының жоғарылауын, сондай-ақ май қышқылының тотығуындағы оң қарынша ақауларын көрсетті. Бір қызығы, бұл инсулинге төзімділік, BMP жеткіліксіздігі және PAH қиылысатын жалпылама әдісті көрсетуі мүмкін. 72,73

Ағымдағы Азық-түлік және дәрі-дәрмек басқармасы PH үшін мақұлдаған терапевтік құралдарға генетикалық нұсқаларды немесе олардың салдарын тікелей өзгертетін агенттер, мысалы, әдейі кірмейді. BMPR2 гендік мутациялар. Дегенмен, мұндай өзара әрекеттесулер болуы мүмкін. Сондай-ақ, мұны дәлелдейтін кейбір дәлелдер бар BMPR2 гендік мутациялар қазіргі уақытта қол жетімді терапияға қатысты жолдардың бұзылуына әкеледі. Мысалы, науқастар BMPR2-ПАХ-да мутациялардың болуына тән эндотелиндік рецепторлар каскадының өзгерістері болуы мүмкін, бұл тек ауруға бейімділікке ғана емес, сонымен қатар қазіргі уақытта қолданылып жүрген эндотелиндік рецепторлардың антагонистеріне фармакологиялық сезімталдыққа да әсер етуі мүмкін. 74 Керісінше, трепростинил, тұрақты простациклиннің аналогы, SMAD3 фосфорлануын төмендету арқылы TGF-β жолын тежейді, бұл өте маңызды, өйткені SMAD3 фосфорлануының шамадан тыс жоғарылауы ауыр науқастарда PAH сезімталдығын арттырады деп саналады. BMPR2 гендік мутация немесе BMPR2 белсенділігі жеткіліксіз. 69,75 Сонымен қатар, силденафил BMP сигналын күшейтеді және жеткіліксіз BMP сигналын ішінара қалпына келтіреді. BMPR2 in vitro гендік мутация. 76 Бұл нәтижелер жеткіліксіз BMP сигнализациясының қазіргі PH-спецификалық фармацевтикалық препараттармен байланысты болуы мүмкін екенін көрсетеді және BMP сигнализациясын мақсатты ету үшін көбірек жұмыс пайдалы қосылыстарды анықтауы мүмкін екенін көрсетеді.

HPAH TGFβ суперотбасымен байланысты гендердегі мутацияларға жатпайды

Айтылғандай, отбасылардың ≈20% анықталатын мутациялар жоқ, бірақ аутосомды-доминантты берілумен сипатталатын отбасылық PAH анық көрсетеді. Келесі ұрпақты секвенирлеу платформаларын дамытудағы соңғы прогресс адам ауруымен қатты байланысты болатын қосымша мутацияларды іздеу үшін экзоманы (және геномды) кең, бейтарап бағалауды жүргізу мүмкіндігін жеңілдетті. 77 Үлкен әсер ететін сирек нұсқаларды (мутацияларды) анықтау үшін бұл тәсілді қолдану жақында HPAH-пен байланысатын және аурудың патогенезіне кеңірек ықпал етуі мүмкін бірнеше жаңа, бірақ биологиялық тұрғыдан негізделген локустардың ашылуына түрткі болды. Екі жағдайда да толық экзомалық секвенирлеу (WES) 2 жаңа PAH-ассоциацияланған генді анықтаумен сәтті қолданылды: KCNK3 және CAV1.

Гендегі мутациялар KCNK3 Адамның TASK-1 ақуызын кодтайтын (Калий арнасы, К субфамилия, мүше 3) екі жаңа генетикалық бірлестіктердің жиірек кездесетіні сияқты. KCNK3 Жақында Ма және басқалары 78 белгілі PAH генінің мутациялары жоқ PAH отбасыларының өзара байланыссыз WES зерттеуіне негізделген. Сайып келгенде, 3 PAH отбасында зиянды қателік мутация болды KCNK3. IPAH жағдайларының үлкен санын скринингтен кейін бір-бірімен байланысы жоқ 3 IPAH пациентінде зиянды салдары болуы болжанған әртүрлі қателік мутациялары бар екені анықталды. Табылған әрбір мутация геннің жоғары сақталған аймағында орын алды және электрофизиологиялық зерттеулерге сәйкес функцияның жоғалуына әкелді. Бір қызығы, функция in vitro фармакологиялық манипуляция арқылы ішінара қалпына келтірілді.

ашылуы KCNK3 күшті биологиялық сенімділікке ие болды, себебі ол 2 кеуек доменіндегі суперфамилиядағы рН-сезімтал калий арнасы болып табылатын TASK-1 кодтайды. 79 Иондық арналар қан тамырларының тарылуын ғана емес, сонымен қатар тамырларды қайта құрудағы әлеуетті рөлін ескере отырып, өкпе тамырларының өрісінде бұрыннан қызығушылық тудырды. Бұл салада биологияны нақтылау бойынша жұмыс жалғасуда, кальций арқылы мембрананың деполяризациясын реттеу үшін иондық арналар арасында күрделі өзара әрекеттесу болуы мүмкін. Мысалы, калий арнасының белсенділігінің төмендеуі кальций арқылы қан тамырларының тарылуын жеңілдетуі мүмкін, бұл олардың арасындағы байланысты бір түсіндіруге мүмкіндік береді. KCNK3 мутациялар және PAH. 80 Таңқаларлық емес, көптеген себептерге байланысты, соның ішінде ықтимал каналопатия KCNK3 Осы уақытқа дейін сипатталған мутанттарда вазодилаторлық сынаққа жауап жоқ. Тәуелсіз көшірме әлі жарияланбағанымен, KCNK3 иондық арналардың айтарлықтай алдыңғы зерттеулерімен үйлесетін ашылым жаңа терапевтиканы алға жылжытуы мүмкін, өйткені TASK-1 арналары арқылы токтарды фармакологиялық манипуляциялау мүмкін. 81

TGF-β жолында анықталатын генетикалық мутацияларсыз басқа үлкен отбасынан шыққан 4 PAH пациенттерін WES көмегімен қайтадан зерттеу үшін бірдей бірлескен топ іс жүзінде бірдей әдісті қабылдады. Бұл отбасында сәйкестік мутациясы, сайып келгенде, кавеолин-1 (CAV1) ген, зиянды функционалдық салдарлардың ықтималдығы жоғары жоғары деңгейде сақталған аймақта. Қосымша 62 туысқан емес PAH отбасын және 198 IPAH пациентін кейінгі бағалау (барлығы анықталмаған BMPR2 мутациялар) де жаңаның тәуелсіз тұжырымын ашты CAV1 IPAH бар туысы жоқ баладағы мутация (сипатталған екі мутация да 3-экзондағы фреймдік мутациялар: c.474delA [P158P fsX22] және c.473delC [P158H fxX22]). KCNK3 ашылуы сияқты, нұсқалар 1000-нан астам этникалық сәйкес келетін ақ, еуропалық бақылауларда генотиптелді және PAH байланысын қолдайтын ешбір сау адамдарда анықталмады. 82

Ал саны белгілі CAV1 TGF-β рецепторларының мутациялары бар отбасылардағы сияқты PAH бар мутанттар төмен KCNK3 мутациялар, CAV1 мутациялар PAH-мен төмен ену және айнымалы экспрессивтілікпен байланысты сияқты. TGF-β және сияқты KCNK3, үшін биологиялық орындылығы CAV1 жоғары. Оның протеиндік өнімі, кавеолин-1, мембраналық тасымалдауда, жасуша сигнализациясында, холестерин гомеостазында және басқа маңызды жасушалық процестерде қызмет ететін кавеолалар деп аталатын плазмалық мембрананың колба тәрізді инвагинацияларын қалыптастыру үшін қажет мембраналық ақуыз. 83–89 Кавеолалар эндотелий, адипоцит, мезенхималық және басқа жасуша түрлерінде көп. 90,91 сияқты KCNK3, алдыңғы зерттеулер әсер етті CAV1, өйткені гаплоинжеткіліксіз тышқандарда тыныс алу жолдары мен өкпе тамырларының ауытқулары бар және тышқандардың эндотелий жасушаларында кавеолин-1 экспрессиясы осы ақаулардың көпшілігін құтқарады. 92-97 Бұған қоса, кавеолин-1 эндотелий жасушаларының боялуының және экспрессиясының төмендеуі PAH пациенттерінің өкпесінде пайда болатыны туралы бұрын хабарланған. 98–101 Бірақ оны табу кезінде CAV1 адамда PAH мутацияға ұшырауы таңқаларлық емес, оның PAH патогенезіндегі ерекше рөлі толық түсінілмеген. Бір қызығы, кавеолин-1 TGF-β сигналын өзгертеді, соның ішінде BMP сигналының төмендеуі, және бөлек, кавеолин-1 төмендеуі STAT3 гиперактивациясымен байланысты, ол BMP сигналын тікелей бәсеңдетеді - бұл екі нәтиже де арасындағы механикалық байланысты қамтамасыз етеді. CAV1 және BMPR2 PAH патогенезіндегі мутациялар. 73,94 Сонымен қатар, кавеолин-1 эндотелийдің азот оксиді синтазасының белсенділігін тікелей төмендетеді, ал кавеолин-1 жоғалуы кавеолин-1 үшін нөл болған тышқандарда PH дамытатын патологиялық экспуберант эндотелий азот оксиді синтаза белсенділігін тудырады. 102 Жақында адам мен кеміргіштерге жүргізілген зерттеулер белсендірілген CD47 кавеолин-1-ді басады деп болжайды, бұл қосылмаған эндотелий азот оксиді синтазасына PAH-ті көтеретін патологиялық реактивті оттегі түрлерін шығаруға мүмкіндік береді. 93,96,100,101,103 KCNK3 сияқты, кавеолин-1 тапшылығы жасуша қызметін өзгертетін айқын, бірақ потенциалды өзара тоқылған механизмдер жаңа терапевтік дамудың негізгі мақсаты болуы мүмкін.

PAH фенотипіне қатысты жаңа гендік ашылулар

Сирек топтамалардың клиникалық көрінісі PAH-пен бірдей болуы мүмкін. PVOD және өкпе капиллярлық гемангиоматозында (PCH) бір-бірінен және PAH-тен ажырату қиын болуы мүмкін PH бар. Осылайша, ағымдағы жіктеу схемасы осы диагноздарды біріктіріп, 1-топ PAH бір ішкі санатында қамтиды. Бұл ішкі санат 1′ ретінде белгіленген: PVOD немесе PCH немесе екеуі де. 1,2 Жақында алынған нәтижелер олардың бірге қосылуын растайды.

Жақында екі бөлек зерттеу тобы PVOD және PCH-мен байланысты бір гендегі жаңа мутацияларды сәтті анықтау үшін WES жүргізді. Әртүрлі туыстықсыз отбасыларды зерттей отырып, екі топ бұл туралы хабарлады EIF2AK4 (сонымен қатар белгілі GCN2) гендік мутациялар аутосомды-рецессивті түрде берілетін отбасылық аурумен байланысты. EIF2AK4 эукариоттық трансляцияны бастау факторы 2 Альфа-киназаны, серин-треонинкиназаны кодтайды. Рецессивті түрде, айырмашылығы BMPR2/KCNK3/CAV1 мутациялар және отбасылық PAH (аутосомды-доминантты ауру), пациенттерде екі аллель үшін де зиянды гендік мутациялар бар. EIF2AK4 ген. Сонымен қатар, теріс отбасылық тарихы бар PVOD және PCD пациенттері де осы гендегі мутациялармен байланысты болды, бұл бұрын танылмаған тұқым қуалайтын ауруды болжайды.

Франциядағы зерттеушілер рецессивті PVOD зерттеулеріне назар аударды және биаллельді мутацияларды тапты EIF2AK4 барлық зерттелген 13 отбасында бар. Сонымен қатар, спорадикалық PVOD жағдайларының 5/20 (25%) бір аллельі бар IPAH жағдайларының пайызына ұқсас биаллельді мутацияларға ие болды. BMPR2 олардың PAH-ті түсіндіру үшін мутация. Барлығы 22 EIF2AK2 мутациялар анықталды, олардың барлығы гендік функцияға зиянды болып көрінді және бұл тұжырымдаманы растайтын күшті негіздік дәлелдер ұсынылды. EIF2AK2 мутациялар PVOD үшін жалпы негіз болып табылады. Гендік мутацияның енуін бағалау қиын болды, өйткені олардың саны аз болды BMPR2 (және ALK1) және аутосомды-доминантты PAH, науқастар EIF2AK4 мутациялардың диагностика кезінде өзгермелі жасы болды, бірақ мутациясыз PVOD пациенттерінен айтарлықтай жас болды. 104 Таңқаларлық емес, бастапқыда 2 пациентке PCH диагнозы қойылды, оны клиникалық және гистопатологиялық тұрғыдан ПВОД-дан ажырату қиын болуы мүмкін. 105 Шындығында, авторлар PCH және PVOD бір ауруды білдіретіні туралы пікірлерін одан әрі қолдайды.

Тәуелсіз АҚШ-тың бірлескен тобы аутосомды-рецессивті PCH жағдайларына назар аударды және биаллельді ашты. EIF2AK4 гендік мутациялар, қайтадан WES әдісін қолданады. Рецессивті PCH бар отбасынан басқа, EIF2AK4 гендік мутациялар 2/10 (20%) спорадикалық PCH жағдайларында анықталды. Таңқаларлық емес, бұл пациенттердің кейбірі үшін фенотиптік анықтау кезінде PCH және PVOD айырмашылығы қиын болды. 106

PVOD және PCH үшін осы жаңа генетикалық қауымдастықтың ашылуы осы 2 ауру субъектісі бір ауру спектрін білдіреді деген тұжырымды қолдайды. Күрделі фенотиптік жіктеуге көмектесетін генетикалық нәтижелердің бұл рөлі PH саласы үшін салыстырмалы түрде жаңа. EIF2AK4 мутациялар да осы аурулардың тұқым қуалайтын сипатын растайды және болашақта осы пациенттерге генетикалық кеңес беру үшін сыни тұрғыдан қарастыруы мүмкін. Жаңа молекулярлық және терапевтік жетістіктер тез пайда болады, сонымен қатар бұл зерттеулерді PVOD және PCH бар қосымша пациенттерге кеңейтеді деп үміттенеміз.

Тұқым қуалайтын гендік мутациялардан басқа: генетикалық модификаторлар және адам PAH-мен жаңа қауымдастықтар

Кез келген генетикалық вариация, мейлі ол сирек кездесетін мутация немесе жалпы вариация болсын, белгілі бір адамда оқшауланбайтындығы анық. Қосымша генетикалық және генетикалық емес факторлар бар және сезімтал адамдар арасында PAH дамуын (немесе жоқ) өзгертетінін болжайтын ақпарат өсіп келеді (1-сурет). Олардың ішінде а BMPR2 гендік мутация, толық енудің болмауы мутацияның болуын білдіреді BMPR2 ген қажет, бірақ фенотиптік экспрессия үшін жалғыз өзі жеткіліксіз. PAH генінің жалғыз мутациясы жоқтардың арасында баламалы генетикалық қауіп факторлары болуы мүмкін. Соңғы 15 жыл ішінде көптеген кандидат гендер мен генетикалық факторлар пайда болды, бірақ олардың барлығы қосымша зерттеуді қажет етеді немесе әлі сенімді түрде қайталанбаған. 68,107–113 Мұнда біз PAH патогенезіне жарық түсіретін зерттеудің бірнеше перспективалы бағыттарын қысқаша көрсетеміз.

1-сурет. Өкпенің артериялық гипертензиясының (ПАГ) дамуының негізгі факторлары. PAH-пен байланысатын белгілі гендегі сирек нұсқаның (мутация) болуы үшін гетерозиготалылық негізгі қауіп факторы болып табылады (мысалы, BMPR2 гендік мутация). Дегенмен, бұл мутациялары бар субъектілерде әрқашан PAH дамымайды, бұл мутациялар жалпы алғанда оқшауланған PAH тудыруы үшін жеткіліксіз екенін көрсетеді. Қосымша факторлар генетикалық бейімді адамда аурудың енуіне ықпал етуі мүмкін. PAH-тың басқа түрлеріне ықпал етуі мүмкін кейбір потенциалды факторлар атап өтілген.

Жабайы типті BMPR2 аллелінің қызметі

Отбасылық және идиопатиялық PAH бар науқастардың өкпелерінен BMPR2 иммундық бояуының қабылданған төмендеуіне қарамастан, BMPR2 мутация күйі. 114 Осылайша, мутацияланған және жабайы тип бойынша BMPR2 ақуызының өндірісін реттейтін факторлар BMPR2 аллельдер қатысты болуы мүмкін. Пәндерді тексеру BMPR2 мутациялар, Хамид 115-тің өндіріс деңгейін жақында көрсетті BMPR2 жабайы типтегі аллель бойынша транскрипт пен белок гаплоин жеткіліксіздігі жағдайында аурудың енуімен байланысты болды. BMPR2 мутация. Бұл жағдайда жабайы түрі BMPR2 аллель негізгі детерминант транскрипт және ақуыз өндірісі болды. HPAH бар мутация тасымалдаушылардың жабайы түрі төмен болды BMPR2 транскрипт деңгейлері бірдей PAH мутациясы бар әсер етпеген мутация тасымалдаушыларымен салыстырғанда. Осылайша, жабайы типтегі аллель арқылы BMPR2 өндірісі генетикалық тұрғыдан сезімтал адамдар арасында аурудың енуін өзгертетін сияқты және аурудың алдын алу үшін жаңа терапевтік мақсат болуы мүмкін. Бұл сонымен қатар HPAH бар науқастардың өкпесінің иммуногистохимиясы арқылы анықталатын BMPR2 ақуызының виртуалды болмауын түсіндіре алады. BMPR2 мутация. 114 Қазіргі уақытта бұл тұжырымды кеңірек бағалау бойынша жұмыс жүргізілуде BMPR2 мутация тасымалдаушылары және PAH қаупі бар басқа субъектілер.

Өкпенің соматикалық мутациялары

PAH өрісіндегі дәстүрлі тәсіл тұқым қуалайтын мутацияларды бағалау болып табылады BMPR2 және басқа гендер, Олдред және басқалар 116 жақында 2-ден өкпені зерттеді BMPR2 өкпеде жаңадан пайда болуы мүмкін екінші соққыны іздеуде HPAH бар мутация тасымалдаушылары. Олар 13-ші хромосоманың ішінде соматикалық мутацияны тапты SMAD9 1 субъектідегі ген, BMP сигнализациясына қосымша қорлауды ұсынады. Бұл жаңа тұжырым әлі қайталанбағанымен, өкпедегі соматикалық мутациялар сезімтал адамдар арасында аурудың енуіне ықпал етуі немесе өзгертуі мүмкін деген тұжырымдаманы қолдайды, бұл басқа салаларда жақсы сипатталған тұжырымдама, мысалы, ісік биологиясы. 117

Жалпы генетикалық вариациялар: CBLN2

PAH патогенезіне қатысты бүгінгі күнге дейін сипатталған ең перспективалы жалпы генетикалық вариация отбасылық және идиопатиялық PAH жағдайларын жақында жүргізілген көпұлтты геномдық қауымдастықты зерттеуден (GWAS) пайда болған болуы мүмкін. BMPR2 гендік мутациялар. Француз зерттеушілері басқаратын PAH-пен байланысты жалпы генетикалық вариацияларды іздеуде 625 PAH жағдайын және 1525 сау бақылау субъектісін қоса алғанда, 2 тәуелсіз жағдайды бақылау зерттеуі жүргізілді. Germain және басқалар 118 18q22.3 локусында маңызды байланысты анықтады, PAH үшін 2.0-ге жуық ықтималдық қатынасы бар. Олар өз тұжырымдарына назар аударды CBLN2 ген, секрецияланған нейрондық гликопротеидтерге жататын церебеллин гендер тобына жатады. Бұрын өкпе ауруымен байланысты болмаса да, олар мРНҚ деңгейлерін анықтады CBLN2 PAH өкпелерінде бақылау топтарымен, сондай-ақ өсірілген PAH алынған эндотелий жасушаларымен салыстырғанда айтарлықтай жоғары болды.PAH-дағы CBLN2-нің нақты рөлін анықтау үшін айтарлықтай қосымша жұмыс қажет болса да, ол өкпедегі жергілікті жасушалық пролиферацияны өзгертуі мүмкін деп саналады.

Жалпы генетикалық вариациялар: жыныстық гормондар

PAH еркектерге қарағанда әйелдерге көбірек әсер ететіні бұрыннан белгілі, бұл жыныспен байланысты факторлар патогенезге ықпал етеді деп болжайды. 9,17 Хромосомалық айырмашылықтар (XX-ға қарсы XY) немесе аберрантты X-инактивациясы ықпал етуі мүмкін болса да, қолдайтын деректердің аздығы бар. 116 Дегенмен, жыныстық гормондардың PAH патогенезіне эпидемиологиялық қатысы бар, сондай-ақ in vitro, in vivo және адам деректеріне негізделген әдебиеттер көбеюде.

2-сурет. Өкпелік артериялық гипертензиямен (PAH) байланысты белгілі мутациялары бар гендермен кодталған ақуыздардың жеңілдетілген схемасы, BMP сигнал беру жолына назар аудара отырып, бірақ жақында сипатталған мутацияларды қосу. PAH-пен байланысатын белгілі мутациялары бар гендер жатады BMPR2, ALK1, Endoglin, Smad9 (кодтайды SMAD 8), CAV1, KCNK3, және EIF2AK4. Ақуыз әрекетінің ықтимал нәтиже сигналы немесе әсерлері қысқаша тізімделген. Айта кету керек, BMP сигналдық ауытқуларының Smad-тәуелсіз әсерлері көрсетілмеген, бірақ цитоскелеттік динамикадағы, жасушалардың тіршілігіндегі және митохондриялық метаболизмдегі өзгерістер сияқты PAH патогенезіне ықпал етуі мүмкін. BMPR2 2 типті сүйек морфогенді ақуыз рецепторын және өсу факторы-β түрлендіретін TGF-β-ны көрсетеді.

Мысалы, MacLean және басқалар 119 және Уайт және басқалар 120 әйелдердің артық болуын көрсететін PAH үлгісін жасау үшін серотонин тасымалдаушысының (SERT) манипуляциясын қолдана отырып, кеміргіштердің PAH-ның генетикалық негізделген үлгісін пайдаланды. Олар SERT (SERT+ тышқандары) шамадан тыс экспрессиялайтын аналық тышқандарда PAH және гипоксия тудырған PAH шамадан тыс көрінетінін көрсету үшін гипоксияны пайдаланды, ал еркек SERT+ тышқандарында жоқ. Сонымен қатар, аналық безді жою ұрғашы тышқандардағы PAH-ны жойды, ал эстрадиол PAH фенотипін қалпына келтірді. Бұл модельдің әйел жыныстық гормондарының серотонин белсенділігінің жоғарылауымен байланысы қызықты биологиялық және эпидемиологиялық байланысты көрсетеді, өйткені ішінара SERT-дегі жалпы генетикалық вариациялар бұрын PAH-да аралас тұжырымдармен зерттелген. 109–111,120,121

Жақында жыныстық гормондардың аберрантты метаболизмі адамның PAH патогенезіне қатысты. өрнек массивтерін пайдалану BMPR2 мутанттар, West et al 122 гендегі негізгі айырмашылықты тапты CYP1B1. CYP1B1Эстрогенді метаболиздендіретін ферментті кодтайтын PAH бар әйелдер мутация тасымалдаушыларында PAH жоқтармен салыстырғанда экспрессия деңгейі 10 есе төмен болды. CYP1B1 негізгі қосылыс эстрогендерді 2-гидрокси және 4-гидрокси метаболиттеріне дейін метаболиздендіреді. 123 Бұл метаболиттер митогенді және пролиферативті болып көрінетін 16-α-гидрокси метаболиттеріне қарағанда аз эстрогенді. 124,125

Біз бұл жұмысты жалпы генетикалық полиморфизмдерді зерттеу үшін жалғастырдық CYP1B1 эстроген метаболитінің деңгейіне байланысты. Көбірек репликацияны зерттеу жүргізілуде, нәтижелер Батыстың массив зерттеуімен сәйкес болды. BMPR2 Мутацияның ену қабілеті аз белсенді N/N үшін гомозиготалылар үшін 4 есе жоғары болды CYP1B1 аллель Asn453Ser полиморфизмі үшін гетерозиготалы (N/S) немесе гомозиготалы (S/S) болғандармен салыстырғанда. Зерттеудің кірістірілген жағдайды бақылау бөлігінде 2-OHE/16α-OHE1 Сау мутация тасымалдаушыларымен салыстырғанда әйелдер HPAH пациенттерінің арақатынасы 2,3 есе төмен болды. 126 Әрине, әйел және еркек жыныс гормондарының және олардың метаболиттерінің әсері осы зерттеу жеткілікті түрде көрсете алатындан әлдеқайда күрделірек болуы мүмкін. Бірақ қазір жыныстық гормондар мен олардың метаболиттерінің өзі ықпал ететінін көрсететін деректер бар BMPR2- делдалдық PAH.

Робертс және басқалардың 127 басқа жұмыстары бір мезгілде ПАГ-тың басқа түрі портопульмонарлық гипертензияның патогенезіндегі жыныстық гормондардың рөлін қолдады. Олар гендердің жалпы вариацияларының эстрогендік сигнал берумен де, портопульмональды гипертензиямен байланысты жасушалардың өсу реттегіштерімен де байланысты екенін анықтады, соның ішінде эстроген рецепторы 1 үшін генді кодтау. Сонымен қатар, жылдамдықты шектейтін қадам болып табылатын ароматазаны (CYP19A1) кодтайтын ген үшін. андрогендердің эстрадиолға айналуында жалпы полиморфты вариация жынысына қарамастан дозаға байланысты эстрадиол деңгейінің жоғарылауымен байланысты болды.

PAH патогенезіндегі эпигенетика

PAH себептерінің алуан түрлілігі және барлық себептер бойынша біріктіруші ДНҚ нұсқаларының болмауы, тіпті отбасылық PAH бар адамдар арасында, ДНҚ-ға негізделген емес жасушалық жады PAH патогенезіне ықпал етеді деп болжайды. Осылайша, эпигенетикалық механизмдердің үлесіне қызығушылық артып келеді. Бұл тұқым қуалайтын, жиі өздігінен жүретін, бірақ қайтымды вариациялар ДНҚ метилтрансферазалары арқылы CpG аралының метилденуі, кодталмаған РНҚ және мүмкін гистонның модификациясы сияқты әр түрлі болуы мүмкін. Мысалы, Арчер және басқалар 128 жақында CpG аралының гиперметиляциясын эксперименттік PH митохондриялық супероксид дисмутаза-2 тапшылығының эпигенетикалық себебі ретінде анықтады, бұл адамның өкпесінің супероксидті дисмутаза-2 төмендеуімен алдыңғы деректеріне сәйкес келеді. Сонымен қатар, микроРНҚ-лардың (miRs) PAH патогенезіне қосқан үлесіне үлкен қызығушылық бар. Осы уақытқа дейін көптеген miR адамның PAH-қа қатысы бар (мысалы, miR-17/92 кластері, miR-26a, miR-27a, miR-124, miR-145, miR-150, miR-204, miR-206) кейбіреулерімен бірақ бәрі де BMP сигналындағы өзгерістерге немесе ДНҚ-ның зақымдануы және жөндеуі сияқты басқа жолдарға қатысты емес, бірақ қосымша зерттеулер қажет. 129–131

Осы және басқа да прогрестің жолдары сезімтал және теориялық тұрғыдан сезімтал емес жеке тұлғаларда PAH-ті ілгерілететін генетикалық және геномдық факторларды түсінудегі прогрестің басқа жолдары PAH саласындағы ашылулар мен прогреске үлкен мүмкіндіктер береді. Келесі ұрпақ секвенциясының қазіргі дәуірі PAH патогенезі туралы түсінігімізді кеңейтуге және терапевтік және емдік терапияға әкеледі деп үміттенеміз. Мысалы, толық экзома, тұтас геном және РНҚ секвенирлеу әдістері бойынша көптеген субъектілерді бағалау бір күні жақын арада жүйелік биологияның кешенді тәсілдері жаңа жетістіктерге қол жеткізетініне уәде береді. Ішкі түріне қарамастан, PAH барлық түрлерін әсерлі түсінуді қамтамасыз ету үшін ақпараттық деректердің күрделі қабаттарын бірге қабаттастыру мүмкіндігі болуы керек.

PAH үшін генетикалық тестілеу

PAH-ассоциацияланған аутосомды-доминантты гендердің белгілі мутацияларына генетикалық тестілеу Солтүстік Америка мен Еуропада бар. BMPR2, ALK1, ҚАЗ, SMAD9, CAV1, және қазір KCNK3 гендер (2-сурет). Қазіргі уақытта Солтүстік Америкада барлық гендерді қамтитын бірыңғай PAH мутация панелі жоқ, бірақ жақын арада біреуі пайда болуы мүмкін. Егер HHT-тің белгілі отбасылық тарихы немесе HHT-ге күшті клиникалық күдік болмаса, PAH-ға тән клиникалық мутацияға тестілеуді сынаудан бастау керек. BMPR2 таралуының жоғарылығын ескере отырып, мутациялар. Отбасылық және идиопатиялық PAH-тен басқа, қазіргі уақытта PH-ның басқа ешбір түрлері клиникалық мутация сынамасын ақтамайды. Қазіргі уақытта жалпы генетикалық нұсқаларға тестілеуді клиникалық тестілеу тәсіліне қосу ұсынылмайды.

Клиникалық генетикалық тестілеуден бұрын және кейін оқытылған мамандардың генетикалық кеңес беруі өте маңызды. 38 Нәтижелерді беру кезіндегі кеңес беру арқылы қолдау көрсетілетін сынаққа дейінгі ақпараттандырылған келісім және консультация барлық қатысушылардың тестілеудің ықтимал нәтижелерін және бұл нәтижелер пациент пен отбасы мүшелері үшін нені білдіруі мүмкін екенін түсінуін қамтамасыз етуі керек. Өткізгіштіктің төмендеуі - бұл өте маңызды болатын көптеген себептердің бірі. 28 Сонымен қатар, ағымдағы мутация сынағы ауру экспрессиясының баламалы генетикалық және генетикалық емес модификаторларының үлесін есепке алмайды.

Педиатриялық PAH пациенті клиникалық генетикалық тестілеуге қатысты ұқсас қиындықтарды тудырады, кейбір қосымша мәселелер қарастырылады. Тұтастай алғанда, генетикалық тестілеу түсінігі күрделі педиатриялық аурудың кеңірек контекстінде кең таралған, сондықтан PAH-пен байланысты генетикалық нұсқаларды сынау іс жүзінде педиатриялық PAH-да жиірек болуы мүмкін, дегенмен осыған қатысты деректер жетіспейді. Тұтастай алғанда, педиатриядағы генетикалық тестілеудің принциптері ересектерге қатысты қолданылады. Дегенмен, клиникалық-генетикалық тестілеу тек отбасына негізделген тәуекелді бағалау мақсатында емес, науқасты бағалау үшін қолданылуы керек екенін есте ұстаған жөн. Өйткені, PAH-ассоциацияланған гендік мутацияны анықтау баланың автономиясының жоқтығын ескере отырып, аға-әпкелер, ата-аналар және т.б. үшін отбасылық қауіп-қатерді бағалау үшін өте ақпаратты болуы мүмкін, бірақ бұл педиатриялық науқасты генетикалық тексерудің негізгі себебі болмауы керек. алдын ала және тестілеуден кейінгі кең ауқымды кеңессіз. Әдетте, мутация сынағы PAH патогенезіне қатысты кеңірек бағалаудың бөлігі ретінде енгізілуі мүмкін, дегенмен бұл PAH бағалауының міндетті компоненті емес.

А-ның симптомсыз ұрпақтары үшін BMPR2 мутация тасымалдаушысы болса, тұқым қуалау мүмкіндігі 50% BMPR2 ата-анадан гендік мутация. Теріс генетикалық экран өте сенімді - байланысты мутацияның болмауы субъектінің PAH қаупін нөлге жуықтайды. Бірақ анықталатын мутацияның болуы өмір бойы сынақтан бұрын ықтималдық қаупін екі есе арттырады. Әйелде PAH ықтималдығы еркекке қарағанда (0,5×0,42=0,21) жоғары болғандықтан (0,50×0,14=0,07), ауру қаупі бірдей емес. Ер адам үшін отбасын анықтау BMPR2 мутация өмір бойы тәуекелді ≈7%-дан 14%-ға дейін өзгертеді. Әйел үшін отбасын анықтау BMPR2 мутация өмір бойы тәуекелді ≈21%-дан 42%-ға дейін өзгертеді. Қосымша зерттеулер қажет болғанымен, көптеген тергеушілер а BMPR2 мутация гипоксияға қысымның жоғарылауы сияқты өкпе тамырларының дамуы мен функционалдық ауытқуларымен байланысты. 132

IPAH жағдайлары үшін генетикалық тестілеу қарастыруға лайық, дегенмен бұл тақырып осы салада даулы. Оқиға IPAH жағдайлары үшін а BMPR2 мутация адамның отбасына деген алаңдаушылығына байланысты елеулі алаңдаушылық тудыруы мүмкін. Елеулі эмоционалдық стресс тұқым қуалаушылықтың кінәсі деп аталатын науқас үшін де, хабардар отбасы мүшелері үшін де айтарлықтай ауыртпалық болуы мүмкін. 133 Керісінше, теорияда тұқым қуалайтын аурудың ашылуы ауруды ертерек анықтау үмітімен отбасын скринингке және мұқият бақылауға мүмкіндік береді.

Дегенмен, мутацияға оң сынақтан өткен, бірақ қазіргі уақытта PAH белгілері немесе белгілері жоқ адамдарды басқаруға арналған практикалық нұсқаулық жоқ. Қажет болса да, скринингтің және клиникалық маңызды ауруды ерте анықтаудың ең жақсы стратегиясын анықтауға арналған зерттеулер жүргізілген жоқ. Кем дегенде, мұндай адамдар әрбір 3-5 жыл сайын клиникалық инвазивті емес эхокардиографиялық скринингтен өтуі керек. 134 Бұл ұсынысқа сәйкестігі белгісіз және хабарланбаған. РН-спецификалық терапиялардың өсіп келе жатқан тізімі бар, олардың кейбіреулері РН жоқ субъектілерде кеңінен қолданылған (мысалы, эректильді дисфункция үшін силденафил және тадалафил), оларды бір күні маңызды қауіп тобындағылар үшін бастапқы профилактика құралы ретінде пайдалануға болады. PAH дамуының (мысалы, сау BMPR2 белгілі отбасылық PAH бар отбасылардағы мутация тасымалдаушылары). Дегенмен, мұндай көзқарасты растайтын немесе жоққа шығаратын қазіргі деректер жоқ. Қандай препараттарды таңдау керектігін, егер олар пайдалы болса және бастаудың оңтайлы уақытын анықтау үшін PH-спецификалық терапияларға арналған бастапқы профилактикалық сынақтар қажет. Бұл өте маңызды, себебі PH-спецификалық терапия қымбат, күрделі, қалыпты режимді бұзады және елеулі жанама әсерлері болуы мүмкін.

Ғаламдық қорытындылар

PAH генетикалық негізі туралы біздің түсінігімізді жетілдіру үшін үлкен прогреске қол жеткізілді. BMPR2 отбасылық PAH гендік мутациялар. Атап айтқанда, қазіргі уақытта жүргізіліп жатқан келесі буынды секвенирлеу және геномикалық революциялар соңғы 5-10 жыл ішінде прогреске қол жеткізді. Дегенмен, негізгі сұрақтарға жауап беру керек. PAH зерттеулерінің болашағы күрделі биологиялық желілер мен сезімтал адамда PAH-ті дамытатын оқиғалар туралы жан-жақты түсінуді қамтамасыз ету үшін барлық деректер көздерін біріктіруі керек. 135 Жүйеге бағытталған мұндай көп деңгейлі құрылым өте маңызды болады, өйткені біз генетикалық және басқа түрдегі вариациялар оқшауланған жағдайда сирек кездесетінін мойындаймыз. Уақыт өте келе молекулярлық оқиғалардың тән күрделілігі қоршаған орта әсерлерімен үйлескенде, PAH фенотипін ілгерілету үшін қиылысатын маңызды негізгі және кіші вариацияларды анықтау үшін түсіну керек. Сонда ғана біз адамның осы жойқын ауруын өзгерту үшін генетикалық және өсіп келе жатқан геномдық прогресті оңтайлы пайдалана аламыз.

Науқас сұрақ қояды...

Неге мен? Мен отбасымдағы басқа біреудің бұл ауруға шалдыққанын, мерзімінен бұрын қайтыс болғанын немесе ұқсас белгілерге ие болғанын білмеймін.

Біздің пациенттің идиопатиялық өкпелік артериялық гипертензия (PAH) диагнозының салдары түсінікті. Отбасылық тарихтың жоқтығына қарамастан, идиопатиялық PAH пациенттерінің ≈20% -ында PAH-пен байланысатын белгілі генде анықталған мутация бар. Бұл көбінесе 2 типті сүйек морфогендік ақуыз рецепторының (BMPR2) мутациясы. BMPR2 мутациясын анықтаудың терапевтік салдары қазіргі уақытта PAH бар пациентке қатысты болмаса да, зерттеушілер болашақ терапевтік даму үшін бұл мәселені белсенді түрде жалғастыруда.

Мен балалы болғым келеді. Мен бұл ауруды балаларыма беру туралы алаңдауым керек пе және нақты білу үшін қандай да бір сынақтан өтуге болады ма?

Науқасымыз көбею мәселесін ақылмен көтереді. Гендік мутацияны, соның ішінде BMPR2 тестін қарастыру мүмкіндігі бар. Бұл пациенттің PH дәрігерімен келісімде орындалуы керек және талқылауды жеңілдету үшін генетикалық кеңесшімен ақпараттандырылған генетикалық кеңесті қамтуы керек. Егер пациент мутацияға тестілеуді таңдаса және ол BMPR2 мутациясына ие болса, бұл оның балалары үшін алаңдаушылық тудыруы мүмкін. BMPR2-ассоциацияланған PAH аутосомды-доминантты ауру болғандықтан, теориялық тұрғыдан 1 BMPR2 мутациясының тұқым қуалауы PAH сезімталдығын күрт арттырады. Алайда, ену қабілетінің төмендеуіне байланысты, BMPR2 мутациясының болуы адамның өмір бойы PAH дамытатынына кепілдік бермейді. Патогендік BMPR2 генінің мутациясы бар адамдар үшін PAH даму қаупі ≈20% құрайды (ерлер мен әйелдер үшін бұл қауіп бірдей емес, бірақ біз қарапайымдылық үшін 20% қолданамыз). Осылайша, BMPR2-ассоциацияланған PAH бар ата-анасының салдарынан адам баласының PAH даму қаупін шамамен есептеу келесідей:

Бірінші мәселе: BMPR2 мутациясы бар ата-ананың бұл мутацияны баласына беру мүмкіндігі 50%.

Екінші мәселе: BMPR2 мутациясы бар адамның өмір бойы PAH дамуының 20% ықтималдығы

Математикалық бағалау: 0,50×0,20=0,10=10% пациенттің баласында ПАГ дамуының қаупі.

PAH-байланысты гендер үшін мутация сынағы осы гендердегі мутацияларды анықтауға арналған талдауларда тәжірибесі бар клиникалық зертханада жүргізілуі керек. Клиникалық генетикалық тестілеу үшін қазір әр континентте бірнеше осындай зертханалар бар. Тестке дейінгі және постгенетикалық кеңес пациенттер мен олардың отбасыларына тестілеудің маңызды құрамдас бөлігі болып табылады.

Сондай-ақ жүктіліктің өздігінен ПАГ бар анаға қауіп төндіретінін білу маңызды, оның көптеген себептері бар, соның ішінде жүктілік кезінде денеде сұйықтықтың сақталуы оң жүректің жұмысына қосымша стресс туғызады. палаталар, ол сол кезде жиі бұзылады. Жүрек қызметінің нашарлауы ана мен ұрықтың өміріне қауіп төндіруі мүмкін. PAH бар науқаста жүктілік сәтті аяқталуы мүмкін болса да, ол жоғары қауіпті жүктілік болып саналады және көптеген мамандардың өте мұқият басқаруын, ұзақ бақылауды және ауруханаға жатқызуды талап етеді.

Істің сипаттамасы үшін кіріспе мақаласын қараңыз E.D. Михелакис, 109 бет.

Қан айналымын зерттеу Өкпенің артериялық гипертензиясына арналған жинақ

Өкпенің артериялық гипертензиясы: кеше, бүгін, ертең

Өкпенің артериялық гипертензиясы: клиникалық синдром

Өкпелік артериялық гипертензияның қазіргі клиникалық менеджменті

Өкпелік артериялық гипертензияның метаболикалық теориясы

Өкпенің артериялық гипертензиясының патогенезіндегі қабыну және иммунитет

Өкпенің артериялық гипертензиясындағы оң қарынша: метаболизмнің, ангиогенездің және оң жақ қарыншаның жеткіліксіздігінде адренергиялық сигналдың бұзылуы

Өкпенің артериялық гипертензиясының генетикасы

Қонақ редактор: Эвангелос Микелакис


PAH генінің мутациясы - Биология

Фенилаланин гидроксилаза және фенилкетонурия үшін аллельді вариация

Фенилаланин гидроксилазасының (PAH) локусы 13 экзонмен [жасыл жолақтармен] кеңінен бөлінген 14 интронды [қара жолақты] қамтиды. 2007 ж OMIM тізімі енгізілген 67 аллельдік нұсқа осы локустың ферментативті белсенділігіне әсер ететіні белгілі. Қатысқан мутациялардың орналасуы жоғарыда көрсетілген. Барлық экзондар мен көптеген интрондарда кем дегенде бір белгілі мутация бар. Төмендегі кестеде шамамен үштен бір бөлігі қандағы фенилаланин деңгейінің клиникалық емес жоғарылауын (гиперфенилаланемия) тудыратынын көрсетеді. PKU-ға әкелетін қалған үштен екі бөлігінің жартысынан көбі аминқышқылдарының алмастырылуына әкелетін қате мағынадағы мутациялар болып табылады. Қалғандары мағынасыз мутациялар арасында азды-көпті тең бөлінеді (' Аялдамалар '), жоюлар және транскрипциядан кейінгі сплайсинг қателері интрондар (аралық реттілік немесе IVS мутациялары). [in 2013, the OMIM тізімге 600-ге жуық аллельдік нұсқа кіреді].

Дегенмен, бұл тізім дәрігерлердің немесе тергеушілердің назарына түскен PAH нұсқаларына негізделгенін ескеріңіз. Бұл локустағы мутациялардың көпшілігі фенотипке әсер етпеуі мүмкін, сондықтан анықталмады.


Материалдар мен тәсілдер

Жасуша мәдениеті және жағдайлары

Hep3B және HepG2 адамның гепатома жасушаларының 5% ұрықтың ірі қара сарысуы (FBS), 1% глутамин және 0,1% антибиотик қоспасы (пенициллин/стрептомицин) қосылған минималды маңызды ортада (MEM, Sigma Aldrich) стандартты жасуша мәдениеті жағдайында өсірілді. (37°C, салыстырмалы ылғалдылық 95%, СО 5%2).

Минигендердің құрылысы

In vitro сплайсингті бағалау үшін екі түрлі миниген конструкциялары қолданылды. Бірінші құрылымда (pSPL3 minigene), адамның фрагменті PAH оның ішінде интрон 10 92 бит (қалыпты ұзындық 556 бит), экзон 11 және интрон 11 100 бит (толық ұзындығы 3130 б.) дейін қысқарды, интрон 10 (5'-TGAGAGAAGGGCACAAATG-3') орналасқан праймерлер арқылы күшейтілді. интрон 11 (5'-GTAGACATTGGAGTCCACTCT-3'). Ген фрагменті және фланк аймағы pGEMT векторына (Promega) клондалған. Енгізу EcoRI көмегімен кесіліп, кейін pSPL3 клондалады.Екінші құрылымға (pcDNA3.1 minigene) экзон 10, толық интрон 10, экзон 11, 11 интронның 1958 bp және pcDNA3.1+ клондалған экзон 12 кіреді [22].

Құрамында c.1199+17G>A және c.1199+20G>C мутациялары бар вариант минигендер 5'-GTGAGGTGGTGACAAAAGGTAGGTACG3GACAAAGGTACG5'-GTGAGGTGGTGACAAAAGTAGGTACG3GACAAGTACGGTACGGACGACGGACGACGACGACGGACGACGGACGACGGGACGACGGGACGACGGACGGACGGACGGACGGACGACGGACGACGGACGACGGACGGACGGACGGACGGGACGGACGGACGGGACGACG5GGATACG3Praymer көмегімен QuikChange Lightning Kit (Agilent Technologies, Santa Clara, CA) арқылы сайтқа бағытталған мутагенез арқылы жасалды. 3', сәйкесінше және олардың кері толықтауышы. Жою үшін біз c.1199+13_1199+19del (5'-AAGGTGAGGTGGTGAGAGCCACTAGCTCTG-3'), c.1199+17_1199+22del (5'-AAGTAAGGTGAGGTGGTGACAAACCACTAGCTCTG-119+ (c.2_9)+ (c.1199+13_1199) және c.5_9del (5'-AAGGTGAGGTGGTGAGAGCCACTAGCTCTG-3') қолдандық. -AGGTGAGGTGGTGACAAAGGTACTAGCTCTGGG-3') және олардың кері толықтауышы. 5' қосылу орнын оңтайландыру үшін c.1199+3G>A_+6G>T мутациялары жабайы типтегі минигенге 5'- GAGTTTTAATGATGCCAAGGAGAAAAGTAAGGTAAGTTGGTGAC-3' праймерін және оның кері комплементін пайдаланып енгізілді. Біз сондай-ақ құпия интрондық қосылыс орнында өзгерістер енгіздік: c.1199+18G>C және c.1199+15 A>C/+20G>A 5’-GAGGTGGTGACAAAAGCTGAGCCACTAGCTCT-3’ және 5’-GAAAGTAAGGTACTAGTAGGGGGверс. Бөлгіштер учаскеге бағытталған мутагенез арқылы енгізілді.

U1snRNA құрылымдары

Ата-аналық U1 snRNA клоны pG3U1 (түпнұсқа U1) [34], pHU1 туындысы [35] болды. Біз U1 WT, U1 18GT, U1 MUT+17 және U1 MUT+20 нұсқалары арасындағы ретті ауыстыру арқылы жасадық. Bclмен және BglЭкзонның 11 5' қосылыс аймағына (U1 WT), интрондық криптикалық қосылыс орнына (U1 18GT) және мутациялары бар интрондық криптикалық учаскеге +17 (U1 MUT+17) немесе +20 толық комплементарлы мутант олигонуклеотидтері бар II учаскелер (U1 MUT+20).

Өтпелі трансфекциялар және сплайсинг талдауы

Минигендік талдаулар үшін Hep3B жасушалары 2 мл 5% MEM-де 4x10 5 тығыздықта алты шұңқырлы пластиналарға себілді және бір түнде өсірілді. Жасушалар JetPei ДНҚ трансфекциялық реагентінің (Polyplus, Нью-Йорк) көмегімен бір ұңғымаға 2 мкг жалпы ДНҚ мөлшерімен трансфекцияланды. U1 snRNA шамадан тыс экспрессия эксперименттері үшін жасушалар 1 мкг жабайы типті немесе мутантты минигендермен трансфекцияланды және 1 мкг U1 snRNA нұсқаларымен бірге трансфекцияланды. Жасушалар 48 сағаттан кейін трипсинация арқылы жиналды. Жалпы РНҚ Trizol Reagent (ThermoFisher) және фенол-хлороформ экстракциясы арқылы бөлініп алынды. cDNA синтезі NZY First-Strand cDNA Synthesis Kit (NZYtech) көмегімен орындалды. Сплайсинг талдауы эндогенді анықтауды болдырмау үшін арнайы праймерлер көмегімен FastStart Taq Polymerase (Roche) көмегімен ПТР күшейту арқылы жүзеге асырылды. PAH ген экспрессиясы: pSPL3 минигені үшін SD6 (5'-TCTGAGTCACCTGGACAACC-3') және SA2 (5'-ATCTCAGTGGTATTTGTGAGC-3') және PAH 10-11-12 S (5’-GGTAACGGAGCCAACATGGTTTACTG-3’) және PAH pcDNA3.1 минигені үшін 10-11-12 AS (5’- AGACTCGAGGGTAGTCTATTATCTGTT-3’). Соңғы нүктедегі ПТР күшейту өнімдері Fragment AnalyzerTM (Advanced Analytical) көмегімен 2% агарозды гель электрофорезі және/немесе капиллярлық гель электрофорезі арқылы талданды және олардың сәйкестігі Sanger секвенциясы арқылы расталды. Тәжірибелер кем дегенде екі рет жасалды. Экзонды қосу/эксонды өткізіп жіберуге сәйкес келетін жолақтардың салыстырмалы саны ImageLab бағдарламалық құралын пайдалану арқылы лазерлік денситометрия арқылы бағаланды және экзонды өткізіп жіберу пайызы ретінде (әр жолдағы екі жолақ қосындысына қатысты) хабарланды.

Эндогенді сплайсингтік талдау PAH транскрипттер Hep3B және HepG2 жасушаларында және Мадридтегі CEDEM диагностикалық зертханасынан алынған анонимді адам бауыр үлгісінде орындалды. Циклогексимидпен өңдеу үшін егін жинаудан 6 сағат бұрын қоректік ортаға 40 мкг/мл циклогексид қосылды. РНҚ экстракциясы жоғарыда сипатталғандай орындалды және күшейту үшін 10 (5’-ACTGTGGAGTTTGGGCTCTG-3’) және экзон 12 (5’-ACTGAGAAGGGCCGAGGTAT-3’) гибридтелетін праймерлер пайдаланылды.


Фенилкетонурия және онымен байланысты гиперфенилаланинемиялардың молекулалық негіздері: адамның фенилаланин гидроксилаза геніндегі мутациялар мен полиморфизмдер

Қазіргі уақытта әртүрлі этникалық топтардың көптеген пациенттерінде фенилкетонурия немесе гиперфенилаланинемия тудыратын адамның фенилаланин гидроксилаза геніндегі мутациялар анықталды. Бұл мутациялардың барлығы PAH локусында спецификалық шектеу фрагменті полиморфизмінің гаплотиптерімен жоғары дәрежелі байланысты көрсетеді. Бұл мутациялардың 50-ге жуығы бір негізді алмастырулар, оның ішінде алты мағынасыз мутация және сегіз сплайсинг мутациялары, қалғандары қате мутациялар. Бір сплайсингтік мутация кадрға 3 амин қышқылының кірістірілуіне әкеледі. Екі немесе 3 үлкен делеция, 2 жалғыз кодон жойылуы және 2 жалғыз негіз делециясы табылды. Міндетті емес мутациялардың он екісі жоғары мутагенді CpG динуклеотидтерінің метилденуі және кейінгі дезаминденуі нәтижесінде пайда болады. Осы учаскелердің бірнешеуінде әртүрлі популяцияларда әртүрлі гаплотиптермен ассоциациялар тудыратын қайталанатын мутация байқалды. Барлық қате мутациялардың жартысына жуығы in vitro экспрессиялық талдау арқылы зерттелді және қалдық PAH белсенділігі мен аурудың фенотипі арасында маңызды корреляция байқалды. Молекулалық әдістемелердегі үздіксіз жетістіктер жаңа мутацияларды анықтау және сипаттау қарқынын күрт арттырғандықтан, мутациялардың бұл тізілімі кезеңді түрде жаңартылып отырады. © 1992 Wiley-Liss, Inc.


Мәліметтер қоры

Біз PAH мутациялары үшін реляциялық мәліметтер базасын әзірледік. Жазбалар Мутацияларды талдау консорциумының мүшелерінен (26 елдегі 81 зерттеуші, дерекқорда тізімделген), тәуелсіз жіберулер арқылы және әдебиеттерге тұрақты сауалнама арқылы келеді.

Қол жетімділік

Консорциум ақпараттық бюллетень мен дерекқордың қағаз көшірмесін таратады. Электрондық пішінде MS-DOS 3.3 және Microsoft Windows 3.0 немесе одан жоғары нұсқасы бар IBM үйлесімді компьютерде кемінде 4 Мег оперативті жады және 5 Мег компьютерде дербес орындалатын етіп жасалған Microsoft FOXPRO 2.6A пайдаланатын арнайы бағдарламалық пакет (WINPAHDB) бар. дискілік кеңістік қажет. Әртүрлі өрістерді іздеуге және Шолу терезесінен жасалған жазбаларды мәтіндік файл ретінде басып шығаруға немесе сақтауға болады. Сондай-ақ, барлық байланысты ақпаратпен бір жазбаны басып шығаруға болады. Консорциум http://www.mcgill.ca/pahdb мекенжайында веб-сайт ашты, мұнда дерекқор «виртуалды» емес (10) «нақты» және желіде қол жеткізуге болады. 2-суретте деректер қорының World Wide Web серверінің басты беті көрсетілген. Жүктеп алуға графикалық құрамдас бөлікті өшіру арқылы жоғары жылдамдықта қол жеткізуге болады.

Адамның PAH генінің жалпы құрылымы (12q24.1 кезінде ~90 кб). Интрондар сәйкес экзонға (тік жолақтар) 3′ нөмірленеді. Полиморфты маркерлер геннің астында көрсетілген (диаллельді маркерлер үшін ашық жәшіктер екі мультиаллельді маркерлер үшін көлеңкеленген жәшіктер). Мутация түрлері таңбалармен белгіленеді (код үшін қорапты қараңыз), геннің астына орналастырылғандар сплайс жетіспейтін аллельдер, оның үстіндегілер - алмастырулар, жоюлар және кірістірулер. Номенклатура Бодет пен Цуй конвенциясына сәйкес келеді (11).

Адамның PAH генінің жалпы құрылымы (12q24.1 кезінде ~90 кб). Интрондар сәйкес экзонға (тік жолақтар) 3′ нөмірленеді. Полиморфты маркерлер геннің астында көрсетілген (диаллельді маркерлер үшін ашық жәшіктер екі мультиаллельді маркерлер үшін көлеңкеленген жәшіктер). Мутация түрлері таңбалармен белгіленеді (код үшін қорапты қараңыз), геннің астына орналастырылғандар сплайс жетіспейтін аллельдер, оның үстіндегілер - алмастырулар, жоюлар және кірістірулер. Номенклатура Бодет пен Цуй конвенциясына сәйкес келеді (11).

PAH Mutation Analysis Consortium Database World Wide Web серверінің басты беті.

PAH Mutation Analysis Consortium Database World Wide Web серверінің басты беті.

Мазмұны

Деректер базасында PAH геніне және осы локустағы аллельдік вариацияға қатысты кең ақпарат бар (1-кесте). Нуклеотидтердің өзгеруі (мутация) вариант аллелі, полиморфты гаплотип, шыққан популяциясы және сәйкес географиялық аймақ арасындағы байланыстармен бірге беріледі. Популяцияның генетикалық вариациясын зерттеудің маңызды белгісі болып табылатын аллельдердің салыстырмалы жиіліктерін мәліметтер базасынан алуға болады. Шектеу сайтын жою немесе құру [соның ішінде кез келген күшейту жасалған шектеу сайты (ACRS)] жазылады және ақпарат көзі (жарияланым немесе қосылу нөмірі бар Дерекқорға жеке ұсыну) беріледі. 3-суретте деректер үлгісі көрсетілген.

Номенклатура

Мутациялар кәдімгі номенклатурамен сипатталады (11). Сплайс мутациялары олардың интрондық нуклеотидтік саны арқылы анықталады, оң сандар интронның 5′ ұшынан басталады, ал теріс сандар сәйкесінше интронның 3′ ұшынан орналасқан аллельді көрсетеді. Мутациялар табылған полиморфты гаплотиптер PAH-спецификалық конвенцияларға сәйкес аталды (5, 7, 9).

PAH мутация дерекқорындағы деректер үлгісі. Жұлдызша мутацияның талданғанын көрсетеді in vitro дерекқордағы бөлек өрісте сипатталған өрнекті талдау нәтижелері.

PAH мутация дерекқорындағы деректер үлгісі. Жұлдызша мутацияның талданғанын көрсетеді in vitro дерекқордағы бөлек өрісте сипатталған өрнекті талдау нәтижелері.

Графикалық мазмұн

Қазіргі уақытта дерекқорда төрт элемент бар: (i) PAH генінің диаграммасы және барлық аллельдердің орналасуы (1-суретті қараңыз). (ii) Квоктың бастапқы тізбегінен қайта нөмірленген cDNA тізбегі т.б. (12) Конецки хабарлаған 5 ′соңында жаңа тұжырымдарды орналастыру үшін т.б. ( 13 ). Бірінші аударылған кодоннан 3′ жылжытқанда cDNA тізбегі оң нөмірленеді, 5′ аударылмаған аймақ бірінші кодоннан жоғары қарай қозғалғанда теріс нөмірленеді. (iii) Гендегі экзон-интрон шекараларындағы нуклеотидтер тізбегі (14). (iv) PAH cDNA (15) бар MUTPRED компьютерлік бағдарламасын пайдалану арқылы алынған геннің болжамды өзгергіштік профилі.

Басқа мүмкіндіктер

Бөлек байланыстырылған дерекқор (Пола Уотерс Ph.D дайындаған) туралы ағымдағы ақпаратты жинақтайды in vitro PAH мутацияларының экспрессиялық талдауы плазмида және и-жүйе мРНҚ деңгейлері, иммунореактивті ақуыз және мутантты фенотипті ақпарат көзіндегі фермент белсенділігі.

1995 жылғы 27 қыркүйектегі жағдай бойынша 4089 мутантты PAH хромосомалары адам популяциясының кең ауқымында және географиялық аймақтарда гиперфенилаланинемиясы бар пробандтардан сипатталды. Олар мутация, гаплотип, популяция және географиялық аймақ арасындағы 798 түрлі ассоциацияларда 248 түрлі фенотипті өзгертетін аллельдерді алып жүрді. Кураторлар дерекқорды және оның қолжетімділігін жақсарту бойынша барлық ұсыныстарды құптайды.