Ақпарат

4.4: Кейбір мутациялардың анықталатын фенотиптері болмауы мүмкін - Биология

4.4: Кейбір мутациялардың анықталатын фенотиптері болмауы мүмкін - Биология


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Үнсіз өзгерістер

Мутагендік өңдеуден кейін негізгі жұп өзгерістерінің басым көпшілігі (әсіресе алмастырулар) фенотипке әсер етпейді. Көбінесе бұл өзгеріс ДНҚ-ның кодталмаған аймағының ДНҚ тізбегінде болады, мысалы: генаралық аймақтар (гендер арасында) немесе интрон аймағында. Сондай-ақ, өзгеріс кодон ішіндегі негізде орын алса да, ол кодтайтын амин қышқылын өзгертпеуі мүмкін (генетикалық код дегенерацияланғанын еске түсіріңіз; мысалы, GCT, GCC, GCA және GCG барлығы аланинді кодтайды) және а деп аталады үнсіз мутация. Сонымен қатар, негізді алмастыру амин қышқылын өзгертуі мүмкін, бірақ бұл өнімнің функциясын өзгертпейді, сондықтан ешқандай фенотиптік өзгеріс болмайды.

Қоршаған орта және генетикалық артықшылық

Сондай-ақ мутация геннің толық функциясын жоғалтуы мүмкін, бірақ мутантты аллель гомозиготалы болса да фенотипте өзгеріс тудырмайтын жағдайлар бар. Фенотиптік өзгерістің болмауы қоршаған орта әсерлеріне байланысты болуы мүмкін: бұл ген өнімінің жоғалуы сол ортада көрінбеуі мүмкін, бірақ басқада. Немесе фенотиптің болмауы генетикаға жатқызылуы мүмкін артықшылық, яғни геномдағы бірден көп локуста ұқсас жұмыс істейтін гендерді кодтау. Осылайша бір геннің жоғалуы екіншісімен өтеледі. Мутациялық талдаудың бұл маңызды шектеуін есте ұстаған жөн: артық функциялары бар гендерді мутантты скрининг арқылы оңай анықтау мүмкін емес.

Маңызды гендер және летальды аллельдер

Кейбір фенотиптер жеке тұлғалардан ұпай алу үшін белгілі бір даму кезеңіне жетуді талап етеді. Мысалы, гүлдердің түсі гүл жасауға жеткілікті жетілген өсімдіктерде ғана белгіленуі мүмкін, ал көздің түсі дамыған көздері бар шыбындарда ғана белгіленуі мүмкін. Дегенмен, кейбір аллельдер белгілі бір фенотип үшін бағаланған ұрпақтардың қатарына қосылу үшін жеткілікті түрде дамымауы мүмкін. Мутациялар маңызды гендер жасау рецессивті летальды аллельдер эмбриональды кезеңде жеке адамның дамуын тоқтатады. Сондықтан мутацияның бұл түрі әдеттегі мутанттық экранда байқалмай қалуы мүмкін, себебі олар скринингтен өтіп жатқан ұрпақта жоқ. Сонымен қатар, эмбриональды летальды рецессивті аллельді қамтитын моногибридті крест ұрпақтары фенотиптік қатынасты 1:0 (бұл 3:0 сияқты) беретін бір фенотиптік класқа жатады. Бұл жағдайда мутация анықталмауы мүмкін.

Гендерді атау

Көптеген гендер алғаш рет мутантты экрандарда анықталды, сондықтан олар әдетте қалыпты функция немесе фенотип емес, мутант фенотиптерінің атымен аталады. Бұл генетика студенттері үшін кейбір шатасулар тудыруы мүмкін. Мысалы, біз X-байланыстырылған генді кездестірдік ақ жеміс шыбындарында. нөлдік мутанттар ақ геннің ақ көздері бар, бірақ қалыпты ақ+ аллельдің қызыл көздері бар. Бұл бізге бұл геннің жабайы түрі (қалыпты) функциясы қызыл көзді жасауға көмектесетінін айтады. Оның өнімі - көздің дамып келе жатқан жасушаларына пигментті прекурсорды импорттайтын ақуыз. Неліктен біз оны «қызыл» ген деп атамаймыз, өйткені оның өнімі солай етеді? Өйткені мутант кезінде көздің түсін өзгертетін оннан астам гендер бар; мысалы күлгін, кинабар, қоңыр, қызыл, т.б. Осы гендердің барлығы үшін олардың функциясы мутантты емес, көздің жабайы түрін қызыл ету үшін қажет. Егер біз осы гендердің барлығына «қызыл» деген атауды қолдансақ, бұл түсініксіз болар еді, сондықтан ген атауы ретінде ерекше мутант фенотипін қолданамыз. Дегенмен, бұл жоғарыда сипатталған «өлімге әкелетін» мутациялар сияқты проблемалық болуы мүмкін. Бұл мәселе әдетте ген атауына сандар немесе орындар беру немесе олардың қалай өлетінін сипаттайтын атауларды жасау арқылы шешіледі (мысалы, біркелкі, бөкселі, түкті, жүнді, т.б.).


Бұрын біз популяцияның генетикалық құрамының қалай зерттелетінін зерттедік. Бұл оқулықта біз генетикалық құрамды өзгерте алатын жағдайларды қарастырамыз. Бұл тақырып эволюцияның орталығы болып табылады. Генетикалық тұрақты популяциялар (Харди-Вайнберг тепе-теңдігіндегілер) эволюцияланбайды, бірақ генетикалық тұрақсыз популяциялар эволюциялық өзгерістерге ұшырайды. Біз генетикалық тұрақтылыққа әсер ететін және эволюциялық өзгерістерге ықпал ететін жағдайларды қарастырамыз. Осы оқулықтың соңында сізде негізгі түсінік болуы керек:

  • Негізін салушы әсері мен тарбок әсері генетикалық дрейфке қалай қатысты
  • Ген ағыны, мутациялар және жұптасу мінез-құлқы генетикалық тұрақтылыққа қалай әсер етуі мүмкін
  • Таңдау аллель жиілігіне қалай әсер етеді

Рибосомалық ақуыздар: саны бойынша мутантты фенотиптер және олармен байланысты ген экспрессиясы өзгерістері

Рибосомалық ақуыздар жоғары деңгейде сақталады, олардың көпшілігі организмдер арасында әмбебап. Барлық рибосомалық ақуыздар бір молекулалық машинаның, рибосоманың құрылымдық бөліктері болып табылады. Дегенмен, рибосомалық ақуыздар жеке мутацияға ұшыраған кезде, олар көбінесе адамның ерекше патологияларын қоса, ерекше және қызықты фенотиптерге әкеледі. Бұл шолу бірнеше эукариоттардағы әрбір рибосомалық ақуыз мутантының барлық хабарланған фенотиптерін жинау және талдау әрекеті болып табылады (Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, Данио Рерио, Бұлшық ет, Гомо сапиенс). Бұл фенотиптер әртүрлі фенотиптер мен жеке рибосомалық ақуыз гендерінің үлестері арасындағы байланыстарды анықтау үшін бейтарап есептеу әдістерімен өңделді. Рибосомалық протеин мутанттарындағы ген экспрессиясының өзгерістеріне шолу, сонымен қатар рибосомаларды профильдеу зерттеулеріне баса назар аударылады. Қолда бар деректер байқалған фенотиптердің көпшілігін есепке алатын үлгілерге нұсқайды. Мұнда ұсынылған ақпарат рибосомалық ақуыздардағы мутациялардан туындайтын фенотиптердің молекулалық негіздері туралы болашақ зерттеулерді де хабардар етуі мүмкін.

1. Шолу

Рибосомалар – хабаршы РНҚ-лардағы (мРНҚ) генетикалық ақпаратқа сәйкес ақуыздарды синтездейтін күрделі молекулалық машиналар [1–4]. Жасушалар мен ағзалардағы байқалатын фенотиптердің көпшілігі рибосомалар түзетін полипептидтердің қызметінен туындайды. Демек, рибосомалар барлық түрлерде генотип-фенотип қатынасының сыни түйінінде болады. Толығымен жинақталған рибосомалардың үлкен және кіші бөлімшелері болады. Эукариоттардағы кіші және үлкен суббірліктер седиментация қасиеттеріне қарай сәйкесінше 40S және 60S суббірліктер деп аталады. 80S толық жиналған рибосомаларды білдіреді. Әрбір суббірлік бір (40S-де) немесе үш (60S-де), рибосомалық РНҚ (рРНҚ) молекулаларынан және 80S рибосомаларында көптеген (ашытқыларда 79, жануарларда 80) белоктардан тұратын рибонуклеопротеинді бөлшек. Рибосомалық ақуыздар рибосомалардың құрылымдық, каталитикалық емес компоненттері болып табылады [5,6]. Бактериялық рибосомалардың құрылымы ұқсас, бірақ олар кішірек және белоктары аз.

Рибосомалық ақуыздардың көпшілігі рибосоманың қызметі мен тіршілігі үшін маңызды. Бүршіктенетін ашытқыларда жалпы 79 цитоплазмалық рибосомалық ақуыздың 15-і маңызды емес [7]. Кейбір жағдайларда бірнеше ген рибосомалық ақуызды кодтай алады. Мысалы, бүршіктенген ашытқыда Saccharomyces cerevisiae, 59 рибосомалық ақуыз әр жағдайда өте ұқсас паралогиялық гендер жұбымен кодталады. Төменде сипатталғандай (1-сурет), рибосомалық ақуыздардағы мутацияларды тасымалдаушы жасушалар тартылған локус пен аллельдерге байланысты фенотиптердің кең спектрін көрсетеді. Бұл шолудың мақсаты осы фенотиптерді жүйелі түрде қарап шығу және олардың қалай пайда болуы мүмкін екенін зерттеу.

Сурет 1. Осы шолуда қарастырылған ағзалардың әрқайсысында рибосомалық белоктардағы функцияны жоғалту мутацияларынан туындайтын ең көп таралған фенотиптердің қысқаша мазмұны. Екінші бағанда фенотиптері сипатталған мутантты гендердің саны, ал үшінші бағанда сол организмдегі кез келген рибосомалық ақуыз генінің мутациялары арқылы анықталған фенотиптердің жалпы саны көрсетілген.

Бұл шолуда басты назар алты эукариотты организмге, үш омыртқасызға (бүршіктенетін ашытқы, құрт, шыбын) және үш омыртқалыларға (балық, тышқан, адам) бағытталған. Келесі тараулар мыналарды сипаттайды: (i) алты организмнің әрқайсысында рибосомалық ақуыздың мутантты функцияларын жоғалту фенотиптерінің толық матрицасын құру (ii) сол фенотиптер мен гендерді анықтауға және топтастыруға арналған есептеу тәсілі. олар (iii) ашытқылардағы рибосомалық ақуыздардың фенотиптерінің функциясының артуына ұқсас талдау (iv) кейбір жағдайларда рибосомалық ақуыз мутанттарының пролиферацияның жоғарылауымен, соның ішінде қатерлі ісікпен байланыстыратын дәлелдемелерді талқылау және (v) байқалған фенотиптерді зерттеу гендік экспрессиядағы өзгерістер контекстінде, әсіресе трансляциялық деңгейде, бұл генотип-фенотип қатынастарын байланыстыруы мүмкін. Соңында, рибосомалық ақуыздың бұзылуының керемет қасиеттері мен салдарын одан әрі талдауды ынталандыру үмітімен осы жерде жасалған барлық деректер жинақтары қоса берілген файлдарда берілгенін атап өткен жөн.

2. Деректерді енгізу

Сұралған рибосомалық ақуыздардың гендік атаулары электрондық қосымша материалда, S1 файлында, әрбір түр үшін бөлек электрондық кестелерде берілген. Түрлер бойынша салыстыруды жеңілдету үшін әрбір ген атауының жанында ген кодтайтын рибосомалық ақуыздың жаңа бірыңғай атауы көрсетіледі [8]. Ашытқы рибосомаларында eL28 ақуызы жоқ екенін ескеріңіз. Әрбір геннің атауы әрбір түр үшін жақсы таңдалған дерекқорды сұрау үшін, сол ағзадағы осы ген үшін барлық қолжетімді фенотиптерді жинау үшін пайдаланылды: SGD for S. cerevisiae ([9], https://www.yeastgenome.org/) WormBase үшін Caenorhabditis elegans ([10], https://wormbase.org/) үшін FlyBase Drosophila melanogaster ([11], https://flybase.org/) үшін ZFIN Данио Рерио ([12], https://zfin.org/) үшін MGI Бұлшық ет ([13] http://www.informatics.jax.org/) үшін OMIM Гомо сапиенс ([14], https://omim.org/). Көбінесе рибосомалық ақуыздың мутантты фенотиптерін сипаттайтын бастапқы есептер мұнда келтірілмеді және алынған фенотиптік матрицаларда кіріс ретінде пайдаланылмаған. Оның орнына, жиналған фенотиптер әр дерекқорға ілеспе дескрипторларымен енгізілгендер ғана болды. Барлық осы түрлер бойынша әдебиеттер кең болғандықтан, бұл фенотиптік матрицаларды құрудың жалғыз практикалық, бейтарап және стандартталған тәсілі болды. Демек, осы шолуды дайындау кезінде сұралған кураторлық дерекқорларда жоқ қосымша фенотиптер болуы мүмкін. Дегенмен, мұндай жетіспейтін жағдайлар болса да, олардың талдау нәтижелеріне айтарлықтай әсер етуі екіталай, өйткені әр ағзаның деректер базасында қазірдің өзінде бар деректер нүктелерінің саны көп.

Әрбір түр үшін фенотиптік матрица бұрын сипатталғандай әрбір генмен байланысты хабарланған фенотиптерді сипаттайтын жүктеп алынған жеке мәтіндік файлдардан жиналды [15]. Әрбір матрица парақта көрсетілген (түрлері_фенотиптер) әрбір түр үшін жеке қосымша файлдың (мысалы, ашытқы фенотиптік матрицасы электрондық қосымша материалда, 2-файл/парақ "ашытқы_фенотиптері" электрондық қосымша материалдағы құрттарға арналған файл, 3-файл/парақ "құрт_фенотиптері" және т.б.). Ашытқылар үшін фенотиптерді күшейту үшін жеке фенотиптік матрица құрылды және ол кейінірек осы есепте бөлек сипатталады.

3. Рибосомалық белок мутанттарының жалпы қасиеттері

Барлық түрлердегі рибосомалық ақуыз гендерінің функцияларын жоғалту мутацияларынан туындайтын фенотиптерге шолу 1-суретте келтірілген. Байқалған фенотиптердің саны айтарлықтай болды, бірақ олардың барлығы рибосомалық ақуыз мутанттарының көпшілігінде байқалған жоқ. Осы ақпараттың барлығын ескере отырып, алғашқы екі анық сұрақ мыналар: функцияларын жоғалтқан рибосомалық ақуыз мутанттарындағы ең көп таралған фенотиптер қандай және түрлер арасында ортақ заңдылықтар бар ма?

Ашытқыда рибосомалық ақуыздарды кодтайтын 137 ген 111 фенотиптің жоғалуына әкеледі (электрондық қосымша материал, файл 2/парақ «ашытқы_фенотиптері»). Бұл бір жасушалы ағзадағы ең көп таралған үш фенотип: бәсекеге қабілеттіліктің төмендеуі, химиялық заттарға төзімділіктің төмендеуі және вегетативті өсудің төмендеуі, сәйкесінше, барлық хабарланған функцияны жоғалтқан мутанттардың 90%, 89% және 80% байқалды. Құрттарда 77 локус мутацияға ұшыраған кезде байқалған 151 фенотиптің ішінде барлық рибосомалық ақуыз мутанттарының 84%-дан астамында дернәсілдің ұсталуы, эмбриональды өлім және ананың бедеулігі хабарланды (электрондық қосымша материал, файл 3/парақ «құрт-фенотиптері»). Шыбындарда ең көп таралған фенотиптер ашытқылар мен құрттардағыдай мутанттардың үлкен бөлігіне ортақ емес. Дегенмен, дернәсілдік кезеңдегі летальдылық, ішінара летальдылық және Минут фенотиптері барлық рибосомалық ақуыз мутанттарының сәйкесінше 49%, 40% және 35% байқалды (электрондық қосымша материал, файл4/парақ ‘fly_phenotypes’). Минут фенотипі жан-жақты зерттелген Дрозофила, және оның жасушалық автономды, кешіктірілген жасушалық цикл прогрессиясы мен жасушаның өсуінің бұзылуынан болатыны бұрыннан белгілі болды, бұл жасуша өлшемін кішірейтуге әкеледі [16]. Рибосомалық ақуыз жеткіліксіздігінің дәрежесі мен Минут фенотипінің күші арасында доза-жауап байланысы бар [17-19]. Зебрабалықтарда рибосомалық ақуыз гендерінің жартысына жуығында мутанттар бар, бұл 200-ден астам ерекше фенотиптерге әкеледі (1-сурет). Осы мутанттардың төрттен үшінен көбінде ең көп таралған фенотиптер бас мөлшерінің кішіреюі, сарысы ұзартылған қалыңдығының азаюы және кішкентай көздер болды (электрондық қосымша материал, файл5/парақ «балық_фенотиптері»). Тышқандарда тек 23 рибосомалық ақуыз генінің мутанттары бар (1-сурет). Бұл тышқандарда 289 ерекше фенотип байқалғанымен, осы мутанттардың шамамен төрттен бірінде табылған ең көп таралғандары дене салмағының төмендеуі, құйрықтың бүгілуі және пренатальды өлімге әкелетін (электрондық қосымша материал, файл6/парақ «тышқан_фенотиптері»). Осы жан-жақты деректерді тұтастай алғанда, ашытқыдан тышқандарға дейін рибосомалық ақуыз гендеріндегі функцияны жоғалту мутацияларының ең ықтимал нәтижелері: жасуша пролиферациясының төмендеуі немесе кешігуі, жасушаның, органның немесе ағзаның мөлшерінің төмендеуі, дамуының кешігуі, тоқтау. немесе өлімге әкелетін (1-сурет электрондық қосымша материал, 2-6 файлдар).

Адамдарда 24 рибосомалық ақуыз генінің мутациялары аурумен байланысты (1-сурет). Осы локустардың 18-інде мутациялары бар науқастарда Diamond-Blackfan анемиясының әртүрлі түрлері дамиды (электрондық қосымша материал, файл7/парақ «адам_фенотиптері»). Қалған рибосомалық ақуыз локустары шаш жасушаларының нашар пролиферациясымен (гипотрихоз), сүйектің нашар өсуімен (дисплазияға және қысқа бойлықпен), бас сүйегінің қысқаруымен (брахицефалия), көкбауырдың болмауымен (аспления), дамудың кешігуімен, рефрактерлік макроцитарлық анемиямен, психикалық артта қалу немесе аутизм. Рибосомалық ақуыз мутациялары Diamond-Blackfan анемиясының әртүрлі түрлерімен байланысты болса да, барлық жағдайларда сүйек кемігінің дұрыс дамып, эритроциттердің жеткілікті мөлшерін өндіруде сәтсіздік бар [20]. Сондай-ақ, жоғарыда талқыланған басқа модельдік жүйелерде байқалатын ең көп таралған фенотиптерге сәйкес келетін қосымша ауытқулар [20] бар. Мысалы, Diamond-Blackfan пациенттерінің жартысына жуығы физикалық ауытқуларға ие. Бұл ауытқулар әдеттен тыс кішкентай бас (микроцефалия), кішкентай төменгі жақ (микрогнатия) және басқа ақаулар ретінде көрінеді. Зардап шеккендердің үштен біріне жуығы да баяу өседі және бойы қысқа болады. Демек, адамдарда, жоғарыда қарастырылған әртүрлі организмдердегі сияқты, рибосомалық ақуыздың функциясын жоғалту мутацияларының типтік фенотиптік көріністері, мәні бойынша, гипопролиферацияның салдары болып табылады.

Бірақ рибосомалық ақуыз мутанттарының ең көп таралған фенотиптерінің сәйкестігі ашытқыдан адамдарға қаншалықты қанағаттанарлық болса да, бұл көзқарас негізгі биологияны жеңілдетеді. «Сіз бір рибосомалық ақуыз мутантын көрдіңіз, олардың барлығын көрдіңіз» деген қорытынды жасау қате болар еді. Өйткені, әрбір организмде қосымша фенотиптердің осындай кең спектрі әлі де бар (электрондық қосымша материал, 2-7 файлдар). Осы фенотиптердің айқын көптігі келесі сұрақтарды тудырады, мысалы: осы күрделілікті азайту үшін әртүрлі топтарда біріктірілген фенотиптерді анықтауға болады ма? Олай болса, осы классификацияны басқаратын рибосомалық ақуыз гендері қандай? Бұл сұрақтарға жауап беру рибосомалық ақуыз мутанттарының арасындағы фенотип-фенотип және ген-фенотиптік бірлестіктер туралы жаңа түсініктерді ұсына алады.

4. Рибосомалық ақуыз фенотиптерінің көп сәйкестік талдауы

Әртүрлі фенотиптерді әртүрлі айнымалылар ретінде қарастыра отырып, байланысты фенотиптік айнымалыларды жеңілдету үшін кеңінен қолданылатын көп айнымалы статистикалық әдістерді қолдануға болады. Бақыланатын фенотиптік айнымалылардың бір-бірімен корреляциялық дәрежесін өлшеу оларды азайтуға негіз береді. Егер екі немесе одан да көп фенотиптік айнымалылар кейбір белгілерді ортақтастырса, онда қатынастың шамасы мен бағытына сүйене отырып, байқалатын күрделілік жеңілдетілуі мүмкін. Жоғарыда аталған принциптерді жүзеге асыратын әдістемелерге факторлық талдау және негізгі құрамдас талдау жатады [21]. Категориялық деректер үшін (мысалы, фенотиптің болуы немесе болмауы) сәйкес тәсіл сәйкестік талдауы [22], деректер жиынындағы фенотиптік айнымалылардағы негізгі құрылымдарды анықтау және топтау болып табылады [15]. Нәтижесінде деректердің ішкі құрылымының төменгі өлшемді көрінісі алынады. Мұндай тәсілдерді әрбір мутант кем дегенде бірнеше фенотипті көрсететін деректер жиынына қолдануға болады. Бұл адамдардан басқа, біз жоғарыда талқылаған модельдік организмдердегі рибосомалық ақуыз мутанттарына қатысты. Адамдардағы барлық дерлік рибосомалық ақуыз мутанттарымен байланысты фенотиптік терминдер әрбір мутантқа тән. Үшін RPL10, байланысты екі ауру бар: аутизм және спондилоэпиметафизальды дисплазия (электрондық қосымша материал, файл7/парақ «адам_фенотиптері»). Анемия рибосомалық ақуыз мутанты бар емделушілерде кең таралғанымен, әрбір локус жеке фенотиптік айнымалылар ретінде сақталған Diamond-Blackfan анемиясының бірегей түріне (электрондық қосымша материал, файл7/парақ «адам_фенотиптері») әкелетінін ескеріңіз. Демек, фенотиптік айнымалы мен рибосомалық ақуыз локусы арасында бір-біріне жақын сәйкестік бар, бұл адам деректер жиынтығының өлшемділігін азайту әрекетін болдырмайды.

Басқа түрлердің әрқайсысы үшін рибосомалық ақуыздың мутантты фенотиптері үшін басқа жерде сипатталғандай бірнеше сәйкестік талдауы (MCA) орындалды [15]. Процесс 2-суретте жинақталған. Әрбір түрдегі алғашқы 20 өлшем бойынша дисперсияның пайызы 3-суреттегі скрипт сызбаларында көрсетілген. Келесі параграфтарда әрбір түр үшін келесілер сипатталатын болады: (i) саны бақыланатын фенотиптердегі дисперсияның көп бөлігін түсіндіретін өлшемдердің/кластерлердің (ii) әрбір өлшемге ең көп үлес қосатын фенотиптердің (талқылау ≥ 0,4 еркін таңдалған корреляция шегі бар фенотиптермен шектелетін болады) және (iii) әрбір өлшемге ең көп үлес қосатын жеке гендер (қайтадан талқылау ≥ 0,4 корреляциясы бар гендермен шектелетін болады). Әрбір ағзаға қатысты барлық деректерді сәйкес қосымша файлдардан табуға болады. Әрбір организм үшін бөлек дисплейлер (4–9-суреттер) нақты фенотиптік айнымалылардың екеуі де айтарлықтай басқарылатын өлшемдерді көрсетеді. және спецификалық рибосомалық ақуыз гендерімен (яғни, екі жағдайда да 0,4-тен жоғары корреляция). Тұтастай алғанда, бұл тәсіл деректердегі дисперсия туралы құнды түсінік бере алады және рибосомалық ақуыздың мутантты фенотиптерінің таң қалдыратын күрделілігін азайтады.

2-сурет. Рибосомалық ақуыз (RP) мутанттары арасында байқалатын фенотиптердің күрделілігін төмендету және нақты топтарға ең көп ықпал ететін гендерді анықтау процесінің схемасы.

Сурет 3. Әрбір организмдегі әрбір өлшеммен түсіндірілетін дисперсияның пайызын көрсететін әрбір түрдегі алғашқы 20 өлшемге арналған скрин графиктері. Барлық өлшемдердің толық тізімін алу үшін «*_eigen» деп белгіленген парақтардағы әрбір ағзаға арналған электрондық қосымша материал файлын қараңыз.

Сурет 4. Ашытқылардағы функцияларын жоғалтқан рибосомалық ақуыз мутанттарының арасында ерекше өлшемдермен/кластерлермен ең маңызды байланысты көрсететін фенотиптер. Осы топтарды басқаратын рибосомалық ақуыздар әрбір жағдайда көрсетілген.

Сурет 5. Құрттардағы функцияларын жоғалтқан рибосомалық ақуыз мутанттарының арасында ерекше өлшемдермен/кластерлермен ең маңызды байланысты көрсететін фенотиптер. Осы топтарды басқаратын рибосомалық ақуыздар әр жағдайда көрсетілген. Көрсетілген барлық белоктар маңызды үлеске ие болды (корреляция коэффициенттері > 0,4).

Сурет 6. Шыбындардағы функцияларын жоғалтқан рибосомалық ақуыз мутанттарының арасында ерекше өлшемдермен/кластерлермен ең маңызды байланысты көрсететін фенотиптер. Осы топтарды басқаратын рибосомалық ақуыздар әр жағдайда көрсетілген.

Сурет 7. Зебрабалықтардағы функцияларын жоғалтқан рибосомалық ақуыз мутанттарының арасында ерекше өлшемдермен/кластерлермен ең маңызды байланысты көрсететін фенотиптер. Осы топтарды басқаратын рибосомалық ақуыздар әрбір жағдайда көрсетілген. Көрсетілген барлық белоктар маңызды үлестерге ие болды (корреляция коэффициенттері >0,4).

Сурет 8. Тышқандардағы функцияларын жоғалтқан рибосомалық ақуыз мутанттарының арасында ерекше өлшемдермен/кластерлермен ең маңызды байланысты көрсететін фенотиптер. Осы топтарды басқаратын рибосомалық ақуыздар әр жағдайда көрсетілген.

Сурет 9. Ашытқылардағы функцияны арттыратын рибосомалық ақуыз мутанттарының арасында ерекше өлшемдермен/кластерлермен ең маңызды байланысты көрсететін фенотиптер. Осы топтарды басқаратын рибосомалық ақуыздар әр жағдайда көрсетілген. Көрсетілген барлық белоктар маңызды үлестерге ие болды (корреляция коэффициенттері >0,4).

4.1. Saccharomyces cerevisiae

Ашытқыда 111 функцияны жоғалту фенотипін 11 өлшемге дейін азайтуға болады. Осы 11 өлшем бірге фенотиптік айнымалылардағы дисперсияның 72% құрады (электрондық қосымша материал, файл2/парақ «yeast_eigen»). Өлшемдердің көпшілігінде (электрондық қосымша материалда тізімделген, файл2/парақ ‘ayeast_Dim’) байланысты фенотиптер кең таралған және берілген өлшеммен қатты байланыспаған (яғни корреляция коэффициенттері 0,4-тен аз). Осы ағзадағы ең көп таралған фенотиптер (мысалы, фитнестің төмендеуі 1) рибосомалық ақуыз мутанттарының 80%-дан астамында көрсетілетінін ескеріңіз. Осыған қарамастан, біз аутофагия мен феромонға сезімталдықтың жоғарылауы 2 өлшеммен айтарлықтай байланысты екенін атап өттік (Р 2 = 0,58 электрондық қосымша материалды қараңыз, файл2/парақ ‘yeast_Dim2’). 2-өлшем барлық 111 фенотип арасындағы дисперсияның 13% құрайды. Феромонға сезімталдықтың жоғарылауы рибосомалық ақуыз мутанттарында байқалған G1 фазасының ұзаруын [23] көрсетеді [24]. Аутофагия – қоректік заттар шектелген кезде немесе басқа күйзеліс кезінде пролиферацияның белгілі бір дәрежесін қолдау үшін қажетті ресурстарды алу стратегиясы [25]. Демек, рибосомалық ақуыздың бұзылуында аутофагияның жоғарылауын күту орынды, ол генетикалық түрде қоректік заттарға кедей, стресстік ортаны көрсетуі мүмкін.

Жоғарыда келтірілген бірнеше сәйкестік талдауының құнды нәтижесі әр өлшемдегі әртүрлі фенотиптік айнымалыларды топтастыруды басқаратын мутантты генді көрсетеді (электрондық қосымша материалда тізімделген, file2/sheet «yeast_genes_cos2»). Бір қызығы, Asc1p рибосомалық протеиніндегі мутациялар (бірыңғай номенклатурадағы RACK1) аутофагия мен феромондарға сезімталдықтың жоғарылауы басым болатын 2-өлшемдегі топтастыруды басқарады (4-сурет). Asc1p/RACK1 кідіртілген рибосомаларда кадрдың ауысуын болдырмайды [26]. Рибосоманың үзілуі көбінесе аминқышқылдарының жеткізілімі шектелген кезде пайда болады [27]. RACK1 жоқ жасушаларда рибосомалардың дұрыс кідіртуге қабілетсіздігі аутофагияны тудыратын жағдайларға ұқсауы мүмкін.

Рентген сәулелеріне төзімділіктің төмендеуі 4 өлшеммен қатты байланысты болды (Р 2 = 0,69 электрондық қосымша материалды қараңыз, файл2/парақ ‘yeast_Dim4’). Бұл өлшем рибосомалық ақуыздың барлық мутантты фенотиптері арасындағы дисперсияның тек 7%-ын ғана құрайды (электрондық қосымша материал, файл 2/парақ «yeast_eigen») және eL20 мутациялары бұл топтастыруға ықпал етті (4-сурет). Бір қызығы, бұл үлес паралогқа тән болды (электрондық қосымша материал, файл2/парақ «yeast_genes_cos2»), RPL20A (Р 2 = 0,77), бірақ бастап емес RPL20B (Р 2 = 0,0009). Паралогқа тән фенотиптер мәселесіне кейінірек қайта ораламыз.

4.2. Caenorhabditis elegans

Құрттарда функцияны жоғалтудың 151 фенотипі де дисперсияның 76%-ын құрайтын 11 өлшемге дейін қысқарды (электрондық қосымша материал, файл3/парақ «worm_eigen»). Өлшемдердің кем дегенде үшеуі нақты фенотиптермен қатты басқарылды (5-сурет). Мысалы, осы метазоандық организмдегі бірінші өлшем барлық фенотиптік айнымалылар арасындағы дисперсияның 22% құрайды, гипопролиферацияның жасушалық, тіндік және организмдік көріністерінің қоспасы, оның ішінде шағын жасушалар мен ядролар, ұсақ немесе жоқ тіндер. , және орталық дене осінің тарылуы (5-сурет электрондық қосымша материал, файл3/парақ 'worm_Dim1'). Соңында, осы фенотиптік топтармен ең маңызды байланысқан рибосомалық ақуыз гендері (5-сурет), негізінен ірі рибосомалық суббірліктің белоктарын кодтады (uL13, eL28, eL43, uL4, uL23 электрондық қосымша материал, file3/sheet 'worm_genes_s').

4.3. Drosophila melanogaster

Шыбындарда 43 функцияны жоғалту фенотиптерін сегіз өлшемге топтау дисперсияның 78% түсіндірді (электрондық қосымша материал, файл4/парақ «fly_eigen»). Құрттардағы сияқты, әртүрлі топтарда ақаулы жасушалардың өсуі, жасушалық цикл, құнарлылықтың төмендеуі немесе өлім сияқты гипопролиферативті көріністер басым болды (6-сурет). Ерекшелік жалпы фенотиптік дисперсияның 6%-ын құрайтын 7-өлшем болды, ол кейбіреулерінің, бірақ барлығының емес, uL10 аллельдерінің әртүрлілікті басу қабілеті басым болды (электрондық қосымша материал, файл4/парақ «fly_Dim7»). Айта кету керек, жасуша циклінің ақаулары RpS2/uS5 мутанты (электрондық қосымша материал, файл4/парақ «fly_Dim5») басқаратын 5-өлшемде басым болды.

4.4. Данио Рерио

Балықтарда рибосомалық ақуыз мутанттарында байқалатын фенотиптік айнымалылардың саны айтарлықтай кеңейеді (1-сурет), омыртқалы жануарлардың биологиясының қосымша күрделілігін көрсетеді. Бір қызығы, бұл фенотиптердің барлығын бес өлшемге дейін азайтуға болады, бұл дисперсияның 86% құрайды (электрондық қосымша материал, файл5/парақ «fish_eigen»). Әрбір өлшеммен ең маңызды байланысты фенотиптер мен гендердің толық тізімі электрондық қосымша материалда, файл5. Олар сондай-ақ 7-суретте схемалық түрде жинақталған. Осы уақытқа дейін талқыланған басқа модельдік жүйелерде көрсетілген типтік гипопролиферативті фенотиптер балықтарда да айқын көрінеді.

Сонымен қатар, бұзылған түпкілікті гемопоэз және ақаулы нейрокраниум морфогенезі 5 өлшеммен тығыз байланысты болды (сурет 7 электрондық қосымша материал, файл5/парақ «fish_Dim5»). Жоғарыда талқыланғандай, бұл фенотиптер Diamond-Blackfan анемиялары бар адамдарда да кездеседі (электрондық қосымша материал, файл7/парақ «адам_фенотиптері»). Балықтардағы бұл топты басқаратын ген rpl5a/uL18 (электрондық қосымша материал, файл5/парақ ‘fish_Dim5’). Адамның орфологындағы мутациялар, RPL5/uL18, 6 типті Diamond-Blackfan анемиясына әкеледі. Соңында, ашытқыдағы өлшемдердің бірінде байқалғандай, жасушалық деңгейде аутофагияның жоғарылауы балықтағы 3-өлшеммен (7-сурет) айтарлықтай байланысты екенін атап өткен жөн. (3-сурет). Тұтастай алғанда, жоғарыда келтірілген бақылаулар көптеген түрлердегі рибосомалық ақуыздың бұзылуының фенотиптік көріністерін сақтаудың тамаша мысалдарын ұсынады.

4.5. Бұлшық ет

Тышқандарда таңғажайып 289 фенотиптік айнымалыларды көрсететін 23 рибосомалық ақуыз мутанттары бар (сурет 1 электрондық қосымша материал, файл6/парақ «тышқан_фенотиптері»). Дегенмен, осы фенотиптердің барлығын үш өлшемге топтастыруға болады, бұл байқалған дисперсияның 83% түсіндіреді (электрондық қосымша материал, файл6/парақ «тінтуірдің_eigen»). Әрбір өлшеммен ең маңызды байланысты фенотиптер мен гендер электрондық қосымша материалда, файл6 және схемалық түрде 8-суретте көрсетілген. Жоғарыда балықтар мен адамдар үшін талқыланғандай, тінтуірдің рибосомалық ақуыз мутанттарында қаңқалық ауытқулар да маңызды.

5. Ашытқылардағы рибосомалық белоктардың қызмет ету фенотиптері

Ашытқыда 75 рибосомалық ақуыз генінің шамадан тыс экспрессиясымен байланысты 24 хабарланған фенотип бар (электрондық қосымша материал, файл 2/парақ «yeast_gof_phenotypes»). Ең көп таралған фенотиптер вегетативті өсу жылдамдығының өзгеруі болды, бұл өсті 32 гендер үшін бірақ төмендеді тағы 19 үшін. Төрт ген үшін (RPL24B, RPL34A, RPL37B, RPS22B), вегетативті өсудің жоғарылағаны немесе азайғаны туралы қарама-қайшы есептер болды (электрондық қосымша материал, файл2/парақ «yeast_gof_phenotypes»). Рибосомалық ақуыздардың шамадан тыс экспрессиясымен байланысты 24 фенотипті үш өлшемде топтастыруға болады, бұл байқалған дисперсияның 61% түсіндіреді (электрондық қосымша материал, файл2/парақ «yeast_gof_eigen»). Жалпы дисперсияның 43%-ын құрайтын 1-өлшем G2-де қалыптан тыс морфология мен жасуша циклінің прогрессиясына негізделген. Ашытқы көбейген кезде поляризацияланған өсу мен бүршіктенудің тән үлгілерін көрсетеді, олар эктопиялық рибосомалық ақуыз экспрессиясы, әсіресе RPS7A/eS7 (9-сурет электрондық қосымша материал, файл 2/парақ «yeast_gof_genes_cos2»). Үлкен және кіші рибосомалық суббірліктердің ақуыздарын кодтайтын көптеген гендер вегетативті өсудің жоғарылауымен сипатталатын 2-өлшемге ықпал етті (9-сурет). Ашытқылардың инвазиялық өсуі де поляризацияланған өсумен байланысты [28]. Инвазивті өсудің болмауы 3-өлшемдегі топтастыруға түрткі болды (9-сурет). Демек, ашытқыда рибосомалық ақуыздар шамадан тыс экспрессияланған кезде өзгерген поляризацияланған өсудің жалпы үлгісі бар сияқты.

6. Рибосомалық белок мутанттарындағы артық пролиферация

Кем дегенде кейбір рибосомалық ақуыздар ашытқыда шамадан тыс экспрессияланған кезде байқалатын пролиферацияның жоғарылауы қызықты, бірақ сонымен бірге таң қалдырады. Бұл әсерлер рибосомалық шығудың немесе қандай да бір белгісіз, рибосомадан тыс функцияның көрінісі екені белгісіз. Жасуша пролиферациясының жоғарылауы рибосомалық функциялармен және көбірек ақуыз синтезімен байланысты болса да, көптеген бөліктерден тұратын алып молекулалық машинаның бір құрамдас бөлігінің шамадан тыс экспрессиялануы мұндай машиналардың көбеюіне қалай түрткі болатыны түсініксіз. Дегенмен, тышқандар туралы жақында жасалған есепте шамадан тыс экспрессияны дәлелдеді RPL15 (eL15) басқа гендердің, соның ішінде жасушалық цикл реттегіштерінің трансляциясын жақсартып қана қоймай, сонымен қатар сүт безі қатерлі ісігі бар тышқандардағы алыстағы метастаздарды дамытты [29].

Пролиферацияның жоғарылауы мен қатерлі ісік сонымен қатар функцияның жоғалуы рибосомалық ақуыз мутациясымен байланысты болды. Жоғарыда талқыланғандай, ерте өмірдегі рибосомопатиялар гипопролиферацияға сәйкес келеді, мысалы, Diamond-Blackfan анемияларындағы ақаулы гемопоэз [30]. Бір ғажабы, кейінгі өмірде бұл науқастардың кейбірі қатерлі ісікке бейім болады [30,31]. Т-жасушалық жедел лимфобластикалық лейкоздың алғашқы адам үлгілерінің 10 пайызында функцияны жоғалту мутациялары бар. RPL22/eL22 [32]. RPL22 мутациялар микросателлитке тұрақсыз колоректальды [33] және эндометриялық қатерлі ісіктерде [33,34] сәйкесінше 77% және 50% жиілікте кездеседі. Сонымен қатар, қатерлі ісікке байланысты мутациялар сипатталған RPL5 (uL18) [35], RPL10 (uL16) [35], RPL11 (uL5) [36], RPS15 (uS19) [37,38], RPS20 (uS10) [39] және RPS14 (uS11) [40,41]. Рибосомалық ақуыздардағы қатерлі ісікпен байланысты мутациялар гипоморфты болып табылады, рибосоманың биогенезін бұзады [30]. Тіпті қате R98S мутациясы RPL10 (uL16) Т-жасушалық лейкозда байқалды, ашытқы мен сүтқоректілердің жасушаларына енгізілгенде рибосома биогенезін нашарлатады және жасуша пролиферациясын кешіктіреді [35]. Рибосомалық протеиндердің ісіктерді басатын гаплоин жеткіліксіздігі ретінде қызмет етуі мүмкін екендігі туралы дәлелдер зебрабалықтар [42] мен шыбындарда [43-45] хабарланған. Дегенмен, бұл нәтижелер жасуша бөлінуіндегі рибосома биогенезінің тікелей, теріс рөлін міндетті түрде қолдамайды. Шынында да, шыбындардағы мұндай әсерлер жасушалардың автономды емес жолдарының арқасында болды [46-48]. Тұтастай алғанда, олардың ақуыз синтезіндегі рөлі контекстінде, дәлелдемелердің көпшілігі рибосомалық ақуыздардың функциясының бұзылуының бұзылуының бастапқы фенотипі гипопролиферативті болып табылады деп болжайды. Олай болса, рибосомалық ақуыздың бұзылуы қатерлі ісіктегі жасушалардың бақыланбайтын пролиферациясын қалай түсіндіре алады? Бір-бірінен ерекшеленбейтін кем дегенде үш мүмкіндік бар:

Рибосомалық ақуыздың бұзылуы төмендейді шоғырлану белсенді рибосомалардың [49-51], содан кейін пропорционалды емес нақты транскрипттердің аудармасына әсер етеді [51,52]. Рибосомалық ақуыздардың өзі жасуша бөлінуінің тікелей теріс реттеушілері болмауы мүмкін, бірақ рибосомалық ақуыз мутанттарында кейбір мРНҚ-ның трансляциясы, мүмкін кейбіреулері ісіктерді басатын рөлдері бар, басқа транскрипттерге қарағанда көбірек репрессиялануы мүмкін, бұл қатерлі ісікке негіз болады. Реттеудің бұл түрінің математикалық негізін Лодиш баяғыда тұжырымдаған [53]. Қысқаша айтқанда, Лодиш моделі трансляциялық тиімділік пен қол жетімді рибосомалар арасындағы сызықтық емес байланыстың арқасында мРНҚ-ға тән әсерлерді болжайды. Рибосома құрамының азаюында, мысалы. рибосомопатиялардағы рибосомалық ақуыздардың бұзылулары кезінде мРНҚ-ның негізгі бастапқы кодонына рибосоманың кіруіне кедергі келтіретін ерекшеліктері бар мРНҚ-лар (мысалы, қайталама құрылым, жоғары ағынды оқу шеңберлері) болады. пропорционалды емес басқа мРНҚ-ға қарағанда трансляциялық тиімділігі төмен. Лодиш моделі болжағандай трансляциялық бақылаудың мРНҚ-ға тән жағдайлары рибосомопатиялардағы [51,52] кем дегенде кейбір фенотиптерді негіздей алады деген ұсыныс ақылға қонымды және қарапайым.

Рибосомалық ақуыздар болуы мүмкін рибосомадан тыс, трансляциялық емес функциялар [54,55]. Рибосома биогенезінің бұзылуы ядролық стрессті тудырады, өйткені бос рибосомалық ақуыздар жинақталады. Rpl22 жоғалуы стресстен туындаған NF-κB жолын белсендіру арқылы тышқандарда қатерлі ісікке әкелуі мүмкін, бұл өз кезегінде Lin28B діңдік факторын іске қосады [32]. Рибосома жинағы бұзылған кезде босатылған рибосомалық ақуыздардың бір бөлігі басқа нысандарды байланыстыра алады. Мысалы, Rpl5, Rpl11 және Rpl23 p53 ақуызын ыдырататын Mdm2 ubiquitin лигазасын тежеу ​​арқылы p53 протеинін тұрақтандырады [55]. Алайда, бұл рибосомадан тыс рөл қатерлі ісікке қалай ықпал ететіні анық емес, өйткені p53 ісік супрессорының тұрақтануы мүмкін гипо-пролиферативті. Rps25/eS25 жоқ адам жасушаларында жақында жүргізілген зерттеу трансляцияны тікелей бақылауға емес, рибосомалық ақуызды жоғалтуға жасушалық бейімделу артықшылықты трансляциядан туындайтын фенотиптерді қоздырады [56]. Бұл сценарийде eS25 жоғалған кезде жасушалық рибосома пулы оның биогенезі мен айналымына байланысты стресске ұшырап, фенотиптерді басқаратын белгілі бір жасушалық күйдің өзгеруін тудырды [56].

Ақырында, рибосомалық ақуыздардың бұзылуы оны өзгертуі мүмкін құрамы белсенді рибосомалардың [57,58]. «Мамандандырылған» рибосомаларға сүйенетін мРНҚ-ның трансляциясы, әсіресе нейрондарда [59] хабарланды. Дегенмен, аудармасы «мамандандырылған» рибосомалармен жүзеге асырылатын транскрипттердің мысалдары жоқ. және рибосомалық ақуыздың бұзылуына байланысты қатерлі ісіктерге әсер етеді.

Жоғарыда аталған модельдердің әрқайсысының жарамдылығына қарамастан, соңғы уақытқа дейін рибосомалық ақуыз мутанттарындағы ген экспрессиясының өзгерістері туралы және, атап айтқанда, трансляциялық тиімділігі туралы ақпарат өте аз болды. барлық сол параметрлердегі мРНҚ. Мұндай білімсіз рибосомалық ақуыз мутанттарындағы генотип-фенотиптік қатынасты механикалық түрде байланыстыру қиын.Дегенмен, соңғы 2-3 жылда кейбір жауаптар келесі бөлімде талқыланатын рибосомалық ақуыз мутанттарындағы рибосома профилін анықтаудың соңғы нәтижелеріне негізделген.

7. Рибосомалық ақуыз мутанттарында ген экспрессиясының өзгеруі

Рибосомалық ақуыз мутанттарында рибосома профилін жасау тәжірибелерін талқыламас бұрын, кейбір мутанттардағы спецификалық ген өнімдерінің экспрессиясындағы бірнеше өзгерістер зебрабалықтарда каталогталғанын атап өткен жөн. Бұл деректер электрондық қосымша материалда, file5/sheet «fish_gene_expression» бар. Ол үш мутанттағы 36 локус деңгейіндегі хабарланған өзгерістерді қамтиды (rpl11, rpl5a, rps19), ол байқалған фенотиптер туралы кейбір түсініктерді ұсына алады. Алайда бұл жағдайларда геннің экспрессиясындағы өзгерістердің қалай пайда болғаны анық болмады.

Рибосомаларды профильдеу рибосомалармен байланысқан мРНҚ-ның барлық бөліктерін сандық анықтау үшін келесі ұрпақ секвенирлеуін қамтиды [60-62]. Ілеспе RNAseq деректерінен әрбір мРНҚ түрі үшін, егер рибосомалармен байланысқан фракция күтілгеннен жоғары немесе төмен болса, бұл мРНҚ-ның бақыланатын тұрақты күй деңгейлерінен сілтеме ретінде есептеуге болады, бұл өскен немесе азайғанын көрсетеді. , сәйкесінше аударма тиімділігі. Адам жасушаларында Хажурия мен әріптестері алмаз-Блэкфан параметрін басу арқылы имитациялады. RPS19 (eS19), RPL5 (uL18), RPS24 (eS24) және RPL11 (uL5) [51]. Барлық жағдайларда гемопоэтикалық жасушаларда рибосомалардың деңгейі төмен болды, бірақ рибосомалардың құрамы өзгерген жоқ. салдары RPL5 және RPS19 басу рибосома профилін жасау арқылы талданды. Транскрипция мен аудармадағы өзгерістер арасында ұқсас болды RPL5 және RPS19 мутанттар, Diamond-Blackfan анемиялары адамның гемопоэтикалық жасушаларында молекулалық өзгерістердің жалпы жиынтығына әкеледі деп санайды. Маңыздысы, эритроидты спецификацияның бастапқы кезеңдерінде әдетте жоғары реттелетін транскрипттердің ішкі жиынын аудару, соның ішінде GATA1— жетілмеген қан жасушаларының дифференциациясын тудыратын транскрипция факторын кодтайтын ол RPL5 және RPS19 репрессияға ұшырады [51]. Рибосомалық ақуыздарды кодтайтын мРНҚ трансляциясы да осы параметрлерде төмен болды [51].

Төменгі рибосома деңгейлері ген экспрессиясында спецификалық және дозаға тәуелді өзгерістерге әкелетіні туралы ұқсас жалпы қорытындыға ашытқыдағы талғампаз зерттеу де қол жеткізілді [50]. Бұл авторлар рибосома профилін жасау арқылы талданған 14 rpl және 9 rps мутанттар, олардың әрқайсысында сәйкес рибосомалық ақуызды кодтайтын паралогтардың біреуі жоқ. Бұл зерттеуде пайдаланылған негізгі фенотиптік көрсеткіш вегетативті өсу жылдамдығы болды. Бір қызығы, ген экспрессиясының өзгеру үлгілері әрбір мутанттың өсу жылдамдығына сәйкес келді [50]. Басқаша айтқанда, егер а rpl және а rps жою өсу қарқынына ұқсас әсер етеді, онда байланысты ген экспрессиясы өзгерістері де ұқсас болады. Адам жасушаларындағы жағдайдан айырмашылығы, Ченг және оның әріптестері рибосома биогенезіне қатысатын гендердің трансляциясы жоғарылағанын (азаймағанын), әсіресе rps мутанттар [50].

Өсу қарқынына жалпы әсерлерден басқа, бірнеше себептерге байланысты неғұрлым нюансты және ерекше әсерлер болуы керек. Біріншіден, рибосомалық ақуыз мутанттарында байқалатын фенотиптердің спектрі әртүрлі және күрделі. Екіншіден, өсу қарқыны қарапайым, сандық параметр болып табылады, бірақ рибосомалық ақуыз фенотиптерін бағалау критерийі ретінде өсу жылдамдығының өзгеруін пайдалану «орманға ағаштарды жіберіп алу» қаупін тудырады. Әртүрлі жасушалық жолдарға әртүрлі рибосомалық ақуыз мутанттары әсер етуі мүмкін, бірақ өсу қарқынына салыстырмалы әсер ететін болса, бұл әртүрлі енгізулер өткізілмеуі мүмкін. Мысалы, кейбір рибосомалық ақуыз мутанттары G1 жасушалық циклінің эквивалентті кешігуін жиі көрсетеді, бірақ әртүрлі себептермен [63]. Кем дегенде, рибосомалық ақуыз мутацияларымен қатты байланысты кейбір фенотиптер өсу жылдамдығына дозаға тәуелді әсерлерімен мүлдем сәйкес келмейді. Мұндай мысал репликативті ұзақ өмір сүру болып табылады. Үлкен (60S) суббірліктің рибосомалық ақуыздарындағы мутация ашытқылардың ұзақ өмір сүруіне ықпал етеді [7,49,64,65]. арасындағы қатынас rpl мутанттар және ұзақ өмір сүру күрделі. Мысалы, Rpl22 қос паралогты жою өміршең, бірақ ұзақ өмір сүрмейді [7]. жалғызбасты rpl22aΔ мутант ұзақ өмір сүреді, бірақ rpl22bΔ жасушалар ұзақ өмір сүрмейді [7] және өсу жылдамдығы арасында ешқандай байланыс жоқ rpl мутанттар және олардың өмір сүру ұзақтығы [66].

Трансляциялық әсерлердің механикалық негізін және олардың фенотиптік салдарын қамтамасыз ету үшін рибосома профилін жасау күшінің тағы бір көрінісі ашытқыдағы паралогтық жұптарды, соның ішінде Rpl22 жұбын зерттеген зерттеулерден келеді [66]. Авторлар дифференциалды түрде аударылған мРНҚ-ның шағын жиынтығын (100-ден аз) тапты. Бұл мРНҚ-лар бір көміртегі метаболизмінің ферменттерін кодтайтын транскрипттер үшін айтарлықтай байытылды. Метаболикалық өлшемдер бір көміртегі метаболизмі Rpl22Ap жоқ, бірақ Rpl22B емес жасушаларда төмендетілген деген қорытындыны қолдады, бұл барлық фенотиптерді есепке алады. rpl22aΔ жасушалар, оның ішінде ұзақ өмір сүру [66]. Жоғарыда айтылған алдыңғы зерттеулердегідей [50,51], рибосомалардың көлемдік құрамы өзгерген жоқ. rpl22 мутанттар [66]. Ченмен келісе отырып т.б. [50], жабайы типті жасушалармен салыстырғанда, жалпы ақуыз синтезі төмендегеніне қарамастан, басқа рибосомалық ақуыздарды кодтайтын транскрипттердің трансляциясы паралогиялық делетанттарда жоғарылады [66]. Ашытқы жасушалары рибосоманың жеке құрамдас бөліктерінің деңгейін жоғарылату арқылы өздерінің төмендеген ақуыз синтезі мүмкіндіктерін толтыруға тырысатын сияқты. Бірақ бұл күш-жігер протеин синтезінің ақауын жаһандық түрде қалпына келтірмейді, себебі рибосомалық компоненттердің өндірісі теңгерімсіз.

8. Қорытынды сөз

Егжей-тегжейлі профильді зерттеулер нәтижесінде пайда болатын жалпы көрініс қарапайым: функцияның жоғалуы рибосомалық ақуыз мутанттары → аз рибосомалар → аз ақуыз синтезі → жалпы гипопролиферация және mRNAs ішкі жиынының дозаға тәуелді, пропорционалды емес трансляциялық бақылауы. Бұл ашытқыдан адамға дейін бұрын жинақталған ең көп таралған фенотиптерге өте жақсы сәйкес келетін кең көзқарас (1-сурет). Өсу қарқынынан бөлінбейтін қосымша, нақтырақ әсерлерді тиісті транскрипттерді трансляциялық бақылау арқылы да есепке алуға болады [66]. Рибосомалық ақуыз мутанттарындағы төменгі рибосома пулымен байланысты стресс сонымен қатар тікелей трансляциялық негізі жоқ стресспен байланысты фенотиптерге әкелетін қайталама өзгерістерді тудыруы мүмкін [56]. Осыған қарамастан, осы уақытқа дейін жиналған дәлелдемелер бойынша, рибосомалық ақуыз мутанттарының әртүрлі фенотиптік ландшафттары, жалпыдан ерекше фенотиптерге дейін, негізінен рибосомалардағы рибосомалық ақуыздардың канондық рөлдерінен туындайтыны көрінеді. Профильдеу зерттеулері құрамы немесе рибосомнан тыс функциялары өзгерген мамандандырылған рибосомалардың қосымша механизмдерін қолдамады, бірақ ол да нақты бағаланбаған. Демек, бұл тұжырымдарды әрі қарай және егжей-тегжейлі тексеру қажет. Бұл әдістемелерді қызығушылық тудыратын фенотиптерді көрсететін рибосомалық ақуыз мутанттарының талдауына қолдану, рибосомалық ақуыздың бұзылуындағы генотип пен фенотип арасындағы қарым-қатынас туралы білімімізді жетілдіретіні сөзсіз, олардың қызықты биологиясын және трансляциялық бақылаудың кеңірек рөлдерін жарықтандырады.


Нәтижелер

Клиникалық фенотип.

Біз JRRP бар 2 ағайынды зерттедік, мұнда 1 пациент (P1) және 2 пациент (Р2), туыстық (бірінші немере ағасы) ата-анасынан туған бельгиялық текті (Cурет 1)А). Басқа ағайындар болған жоқ. Р1 5 жаста дауыстың қарлығуы және қайталанатын ларингит дамыды. Тікелей ларингоскопияда глоттис пен супраглоттисте папилломалар анықталды (1-сурет).Б). Ол келесі жылы көмейдің зақымдануын 8 хирургиялық абляцияны талап етті және жыл сайын жиілігі төмендей отырып, бірнеше рет абляцияны қажет етеді. Р2 туылғаннан кейін көп ұзамай дауысының қарлығуы пайда болды, 20 айда көмейдің папилломатозы анықталды. Оның ауруы P1 ауруына қарағанда ауыр емес және жылына 2-3 абляция қажет болды. Олардың ауру тарихын мұқият ретроспективті шолу екі ағайындыда бірдей жеңіл дерматологиялық ауытқуларды анықтады, оның ішінде төменгі арқадағы, бөкседегі және жамбастағы аздаған алақан және табан сүйелдері кератозды пиларис және беттегі атрофодерма вермикулалары, олардың ешқайсысы медициналық емдеуді қажет етпейді. (Cурет 1Б) іс есептерін қараңыз SI қосымшасы толық мәліметтер алу үшін. Дерматологиялық ауытқулар әдетте JRRP бар басқа емделушілерде байқалмайды, бұл оқшауланған, сондықтан бұл 2 пациентте JRRP синдромдық түрі болды. Ата-анасының ауру тарихы, атап айтқанда, РРП немесе дерматологиялық ауру тарихы жоқ. Гистологиялық тұрғыдан көмейдің зақымдануы коилоцитоздың ошақтық аймақтары және шашыраңқы бинуклеарлы жасушалары бар папилломатозды морфологияны көрсетті, РРП зақымдануларына тән және HPV инфекциясының патогномоникалық (32). (Cурет 1C). P1 (9 үлгі) және P2 (2 үлгі) папилломалары HPV-6 және HPV-11 үшін теріс сыналған, бұл әрбір емделушіде HPV анықталмаған когорттарды зерттеуге сәйкес келеді (16 ⇓ ⇓ –19).

JRRP және дерматологиялық ауытқулары бар бауырластардағы жеке гомозиготалы қате мутация. (А) Асыл тұқымды көрсету NLRP1 особьтардың генотипі. (Б) Р1 клиникалық суреттері (солдан оңға қарай) кеңірдектің папилломаларын, щектердегі атрофодерма вермикулаларын, табан сүйелдерін және бөкселер мен жамбастардағы кератоз пиларисын көрсетеді. (C) Р1-ден кеңірдек папилломасының микросуреттері (солдан оңға қарай) папилломалардың жалпы морфологиясын, биноклеозды жасушалардың аймақтарын (Кірістірілгендер: үлкейтілген), және коилоцитоздың ошақтық аймақтары (көрсеткілер). (D) Функционалдық домендерді, пациенттердің T755N мутацияларының орналасуын (қызыл) және бұрын сипатталған NLRP1 мутацияларының орналасуын (көк) және олардың мұрагерлік режимін (AD, AR немесе кодоминантты [CoD]) көрсететін NLRP1 ақуызының схемалық көрінісі. (Е) T755 консервациясын көрсететін адам NLRP1 протеинінің белгілі ортологтарға сәйкес келуі.

Генетикалық талдау.

Біз P1, P2 және ата-аналардың екеуінде (I.1 және I.2-сурет 1) толық экзомалық реттілік (WES) орындадық.А). WES белгілі ата-аналық туыстықпен сәйкес келетін P1 (3,56%) және P2 (5,13%) (33) гомозиготасының жоғары деңгейін көрсетті. Негізгі құрамдас талдау пациенттердің еуропалық шығу тегін растады (33). Осы туыстық байланысты ескере отырып, біз пациенттердің фенотипіне екі пациентте гомозиготалы және екі ата-анада гетерозиготалы сирек нұсқа жауапты болуы мүмкін деп болжадық. Біз жалпыға ортақ дерекқорларда (ExAC, 1000 Genomes және NHLBI-ESP6500) аздаған аллель жиілігі <0,01 болатын қате, мағынасыз, индель немесе сплайс сайтының мутациясына әкелетін болжамды нұсқаларды таңдадық. Соңында, біз гендердің зақымдану индексі (GDI) >13.38 (34) бар гендердегі нұсқаларды, аннотацияға тәуелді сарқылу (CADD) балы мутацияның маңыздылық шегінен (MSC) (35) төмен нұсқаларды және келесі нұсқаларды алып тастадық. >0,01 (36) ішкі жиілігі бар қара тізіміміз (SI қосымшасы, S1-суретА). Бұл 5 ген бойынша 5 гомозиготалы нұсқаны берді (SI қосымшасы, S1-суретБ). Олардың екеуі ExAC-да сау адамдарда гомозиготалықта болды, бұл олардың пациенттің фенотипіне қатысы жоқ екенін көрсетеді, екіншісі белгісіз генде болды (ZNF417) және екіншісі жүрек өткізгіштігінің ақауларына қатысы бар генде болды (KCNH2) (37). Ең жақсы үміткер нуклеотидтерді байланыстыратын домендегі, лейцинге бай қайталанатын пириндік доменді қамтитын 1 домендегі гомозиготалы қате мутация болды (NLRP1), c.2819C > A (транскрипт 1 нұсқасы үшін NBCI NM_033004), p.T755N (осы жерде T755N). 1473 амин қышқылынан тұратын NLRP1 1 изоформасы қабыну (38) деп аталатын туа біткен иммундық кешеннің сенсоры ретінде әрекет етеді және әртүрлі тіндер мен жасуша түрлерінде көрінеді (https://www.proteinatlas.org/ENSG00000091592- NLRP1/). T755N лейцинге бай қайталанатын (LRR) доменіне сәл N-терминал (Cурет 1)D). P1 және P2-дегі NLRP1 T755N аллельінің гомозиготалығы және оның аурумен отбасылық сегрегациясы Сэнгер секвенирлеуімен расталды (SI қосымшасы, S1-суретC). X-байланыстырылған мұрагерлік үлгісі үшін ұқсас нұсқаны сүзу стратегиясын пайдалану ешқандай үміткер нұсқаларды бермеді (SI қосымшасы, S1-суретD). Сол сияқты, 2 пациент бөліскен де жаңа мутациялар болған жоқ. Осылайша, бұл нәтижелер NLRP1 T755N үшін гомозиготалық P1 және P2-де JRRP генетикалық этиологиясы болуы мүмкін екенін көрсетті.

NLRP1 популяциялық генетикасы.

NLRP1 нұсқасы T755N ешбір жалпыға ортақ дерекқорда (gnomAD, Bravo/TOPMED) немесе әртүрлі жұқпалы аурулары бар >5 000 туыс емес тұлғалардан тұратын ішкі когортада жоқ. T755N CADD арқылы зақымдалады деп болжанады, жоғары балл 23,1, MSC мәні 99% сенімділік интервалы 3,313 (35) жоғары. NLRP1 T755 қалдығы түрлерде жоғары деңгейде сақталады (1-суретЕ). NLRP1 GDI 9,374 құрайды, бұл жалпы популяциядағы мутациялық жүктеменің орташа мөлшерін көрсетеді (34) және төмен немесе орташа теріс таңдауда, Макдональд-Крейтман бейтараптылық индексі 0,400 және 95-процентильдегі қалдық вариацияға төзбеушілік балл. ең аз төзімсіз гендердің (39) дегенмен, алдыңғы зерттеулер аутосомды-рецессивті ауру тудыратын гендер тазартатын іріктеуде емес екенін көрсетті (40). GnomAD-та 1 немесе одан да көп адамдарда гомозиготалықта 40 қате мутация бар, олардың 23-інің CADD көрсеткіші MSC-тен жоғары. ГномАД-да гомозиготалылықта функцияны жоғалтудың болжамды нұсқалары (LOF) табылған жоқ, және pRec (гомозиготалы, бірақ гетерозиготалы емес, LOF нұсқаларына төзбеушілік ықтималдығы) 0,95 (41) құрайды. Жалпы алғанда, бұл нәтижелер T755N NLRP1 ақуыз функциясына зиян келтіруі мүмкін екенін көрсетеді.

NLRP1 T755N - бұл функцияның артуы және In vitro қабынуының белсендіру шегін төмендетеді.

Жақында NLRP1-дегі гермлиндік функцияны күшейту (GOF) мутациялары терінің 3 менделиялық ауруын тудыратыны анықталды. 3 отбасында сипатталған көптеген өзін-өзі емдейтін пальмоплантар карциномасы (MSPC), пирин (PYR) доменіндегі барлық 3 мутация (A54T, A66V және M77T) бар аутосомды доминантты (AD) тұқым қуалау үлгісіне сәйкес келеді (42, 43) . 1 отбасында сипатталған жанұялық keratosis lichenoides созылмалы (FKLC) мутациямен (F787_R843del) мұрагерлік кодоминантты үлгі бойынша бірден LRR доменіне N терминалымен жүреді (Cурет 1).D) (43). 2 отбасында сипатталған артритпен және дискератозбен (AIADK) аутоинфламация аутосомды-рецессивті (AR) (R726W) немесе AD (P1214R) тұқым қуалайды, сәйкесінше N-терминал LRR және функцияны табу (FIIND) домендерінде мутациялар бар. (44). In vitro, MSPC және FKLC ауруын тудыратын аллельдер тұқымқуалаудың әртүрлі режимдеріне қарамастан (AD және кодоминантты) ұқсас GOF шамасын көрсетеді (43). P1 және P2-де FKLC-де байқалғанға ұқсас тері ауытқулары болғандықтан, біз NRLP1 T755N де GOF болады деп болжадық.

Алдымен екеуін де растадық NLRP1 жабайы типті (WT) және T755N cDNAs HEK293T жасушаларында трансфекциялау арқылы қалыпты түрде экспрессияланды (Cурет 2).А). Жарияланды NLRP1 GOF аллельдері өздігінен олигомерленеді және кератиноциттерде IL-1β секрециясын индукциялайды (43). NLRP1 T755N басқа қабыну компоненттерін экспрессияламайтын HEK293T жасушаларында шамадан тыс экспрессияланған кезде, ол өздігінен олигомеризацияланған, бұрын сипатталған NLRP1 GOF нұсқалары M77T және F787_R843del және WT NLRP1 айырмашылығы (Cурет 2)Б). T755N-нің бұл олигомеризациясы FIIND доменіндегі автобөлу орнына, F1212 амин қышқылына ішінара тәуелді, өйткені F1212A бөлінбейтін мутация олигомерленген NLRP1 T755N мөлшерін азайтты (Cурет 2).Б, 6 жолақ). Біріктірілген бұл нәтижелер T755N мутанты басқа NLRP1 GOF мутанттарымен биохимиялық тұрғыдан ұқсас әрекет етеді және өздігінен олигомеризация арқылы қабынудың жоғарылауын тудырады. Сонымен қатар, NLRP1 T755N-нің өлмейтін кератиноциттерде шамадан тыс экспрессиясы бұрын сипатталған GOF аллельдеріндегіге ұқсас, секрецияланған IL-1β өндірісінің жоғарылауына әкелді (2-сурет).C), басқа NLRP1 GOF аллельдерінде көрінетіндей бөлінуге тәуелді болды (2-сурет).C). Функционалдық өсудің шамасы AD (M77T), кодоминантты (F787_R843del) және AR тұқым қуалауынан (T755N) кейінгі аллельдерде ұқсас болды (Cурет 2). Б және C). Қорытындылай келе, бұл нәтижелер NLRP1 T755N in vitro қабынудың жоғарылауын тудыруы мүмкін екенін көрсетеді, бұл бұл аллельдің GOF және осылайша патогенді болуы мүмкін екенін көрсетеді.

NLRP1 T755N - қабынуды белсендіруге арналған GOF. (А) HEK293T жасушаларында NLRP1 WT және T755N протеинінің ұқсас экспрессиясын көрсететін Western Blot. GAPDH Western blot жүктеуді басқару элементі ретінде көрсетілген. Сурет 3 тәуелсіз эксперименттің өкілі болып табылады. (Б) BN-PAGE немесе кәдімгі SDS-PAGE кейінгі HA-белгіленген NLRP1 және NLRP1 WT cDNA-сын шамадан тыс экспрессиялайтын HEK293T жасушаларының лизаттары (2 реплика), T755N, бұрын жарияланған GOF аллельдері (M77T және F878_R843del NRP57N) немесе T757N (NRP57N) үшін вестерн. +F1212A), басқа GOF мутацияларына ұқсас T755N NLRP1 олигомеризациясын көрсетеді. GAPDH Western blot жүктеуді басқару элементі ретінде көрсетілген. (C) NLRP1 аллельдерімен трансфекциядан кейін кератиноциттердің супернатанттарындағы IL-1β ИФА, бұл T755N IL-1β өндірісі үшін GOF екенін және IL-1β өндірісі үшін F1212 позициясында бөліну қажет екенін көрсетеді. NT, трансфекцияланбаған жасушалар EV, бос вектор. Деректер орташа есеппен 4 қайталанады. ***П < 0,001, 1 жақты ANOVA.

P1 және P2 бастапқы кератиноциттері қабынудың өздігінен белсендіруін көрсетеді.

Біз P2 және I.1 (NLRP1 тиісінше T755N/T755N және WT/T755N генотиптері). NLRP1 мРНҚ және ақуыз P2, I.1 және 3 сау бақылаудың бастапқы кератиноциттік сызықтарында ұқсас деңгейлерде экспрессияланды (Cурет 3).А), NLRP1 T755N аллелі сау гетерозиготалы және емделушіден алынған жасушаларда қалыпты деңгейде экспрессияланатынын растайды. Содан кейін біз T755N және WT екенін растадық NLRP1 мРНҚ кератиноциттерде олардың генотипіне пропорционалды түрде көрсетіледі. Жартылай клондау NLRP1 T755-ті қамтитын cDNA I.1 гетерозиготалы жасушаларда транскрипттердің ~50% WT және ~50% T755N екенін көрсетті (3-сурет)Б), T755N мРНҚ екенін болжайды NLRP1 аллель WT-ге тең деңгейде көрсетіледі.P2 және I.1 кератиноциттері IL-1β-ны супернатанттарға шығарды, бұл қабынудың функционалдық деңгейде бастапқы активтенуін болжайды (3-сурет).C). Керісінше, базальды IL-1β шығарылуы бақылау жасушаларында байқалған жоқ (3-сурет).C). Бұл жасушаларды Val-boroPro (талабостат, NLRP1 қабынуын белсендіретін DPP9 ингибиторы) ынталандырғанда (45, 46) бақылау және гетерозиготалы кератиноциттер IL-1β көп мөлшерін шығарды, ал P2-ден кератиноциттерде IL-1β босап шықты. өзгеріссіз қалды (3-суретC). Ұқсас нәтижелер ИЛ-18 үшін де байқалды (3-сурет).D). P2-ден кератиноциттердің талабостаттың жауап беру қабілетінің жойылуы бұл аллельдегі GOF механизмі DPP9 тежелуінің төмендеуіне байланысты екенін көрсетеді. Біріктірілген бұл нәтижелер NLRP1 T755N үшін гомозиготалы кератиноциттердің базальды деңгейде қабынудың активтенуін көрсететінін көрсетеді.

Пациенттерден алынған кератиноциттер NLRP1 протеинінің қалыпты экспрессиясын, қабынудың бастапқы активтенуін және одан әрі NLRP1 белсендіруіне жауапсыздықты көрсетеді. (А) Вестерн дақ (Жоғарғы) және qPCR (ТөменгіP2, гетерозиготалы әке (I.1) және 3 бақылаудан алынған кератиноциттерде NLRP1 экспрессиясы. Сурет 3 тәуелсіз эксперименттің өкілі болып табылады. (Б) NLRP1 WT, T755N транскрипттерінің ТА клондау және Сэнгер секвенциясы арқылы бағаланған салыстырмалы көрінісі NLPR1 Бақылау (CTL), гетерозиготалы әке (I.1) және Р2 кератиноциттерінен алынған cDNA. (Кірістірілген) Сандар реттелген бірегей клондар санына сәйкес келеді. (C) Өңделмеген немесе 3 мкМ талабостатпен (Val-boroPro) 16 сағат бойы өңделген кератиноциттердің үстіңгі қабаттарының IL-1β ИФА. (D) Өңделмеген немесе 16 сағат бойы 3 мкМ талабостатпен өңделген кератиноциттерден алынған үстіңгі қабаттардың IL-18 ELISA. Жолақтар орташа ± 1 SD мәнін білдіреді. Нәтижелер 3 тәуелсіз эксперименттің өкілі болып табылады.

P1 және P2 In Vivo стихиялық қабыну белсендіруіне сәйкес келетін жоғары сарысу цитокин деңгейлерін көрсетеді.

Біз P1 және P2-де қабынудың өздігінен белсендіруінің клиникалық маркерлері бар-жоғын тексердік. Науқастың сарысуы алдымен IL-1β және IL-18 жоғарылауына сыналған, бұл 2 цитокин, қабыну ісігі белсендірілген кезде түзілуі мүмкін (47, 48). Қайталанған талдауларда екі пациентте де IL-18 жоғарылауы байқалды, бірақ IL-1β емес (сурет 4).А), протеиннің LRR аймағына жақын гомозиготалы NLRP1 GOF мутациялары бар науқастардың бұрынғы есептеріне ұқсас (43, 44). Қандағы IL-18 және IL-1β жоғарылауының мұндай алшақтығы NLRC4 арқылы жүретін аутоинфламация (49) сияқты қабынуды белсендірудің басқа бұзылыстарында да байқалады және қабыну аурулары мен аурудың сатысы арасындағы фенотиптік айырмашылықтардың негізі болуы мүмкін (50). P1 және P2 екеуі де көптеген жасуша түрлерінде IL-1β және IL-18 арқылы индукцияланған және IL-6 жоғарыламаса да, қабыну компоненттерінің (51) одан әрі жоғары реттелуіне делдалдық етуі мүмкін TNF-α жоғарылауын көрсетті (Cурет ). 4А), гомозиготалы NLRP1 F787_R853del GOF мутациясы бар бұрын сипатталған FKLC пациентінде де байқалғандай (43). P1 және P2 сарысуында IL-1RA да жоғарылаған (4-сурет).А), созылмалы қабыну белсендіруіне сәйкес. Гетерозиготалы ата-аналарда қан сарысуындағы цитокин деңгейі жоғарылаған жоқ (SI қосымшасы, сурет S2), кез келген клиникалық көріністердің жоқтығына сәйкес. Пациентті және дені сау бақылаудағы перифериялық қанның мононуклеарлы жасушаларын (PBMCs) липополисахаридпен (LPS) немесе жылумен өлтіруді ынталандыру Listeria monocytogenes (HKLM), NLRP1-тәуелсіз түрде IL-1β өндірісін қоздыратын 2 ақылы рецепторлардың агонисттері (52), емделушілер мен бақылаулардағы IL-1β өндірісінің ұқсас деңгейіне әкелді (Cурет 4).Б), TLR лигандтарына қалыпты жауапты ұсынады. Бұл деректер P1 және P2 сарысуларының in vivo қабынуының белсендіру белгілерін көрсеткенін көрсетеді.

P1 және P2-де қабынудың активтенуі. (А) P1, P2 және 3 сау бақылаудан алынған IL-1β, IL-18, IL-1Ra, IL-6 және TNF-α сарысу деңгейлерінің Luminex өлшемдері. Нәтижелер 2 тәуелсіз эксперименттің өкілі болып табылады. (Б) P1, P2 және 2-ден PBMCs стимуляциясынан кейін IL-1β үшін ELISA. Өндірістің қалыпты реттелуін көрсететін NLRP1-тәуелсіз түрде IL-1β индукциялайтын TLR лигандтары бар бақылау. Жолақтар орташа ± 1 SD мәнін білдіреді. Нәтижелер 2 тәуелсіз эксперименттің өкілі болып табылады.


Қатерлі ісікпен ауыратын баланың генетикалық бағалауы

Натаниэль Х. Робин MD, Анна С.Е. Херст MD, MS, балалар ісігі генетикасы, 2018 ж.

Генетикалық физикалық сараптама

Генетикалық физикалық тексерудің әдеттегі медициналық тексеруден бірнеше елеулі айырмашылығы бар. Генетикалық сараптама төменде талқыланатын негізгі генетикалық синдромның белгілерін білдіретін нәзік физикалық мәліметтерді анықтауға бағытталған. Бұл тәсіл «дисморфология» деп аталады, ол құрылымдық даму ауытқуларына баса назар аудара отырып, қалыптан тыс пішінді зерттейді. Баланы (немесе ұрықтың немесе ересек) дисморфологиялық бағалау эмбриологиялық немесе ұрықтың дамуындағы үлкен немесе кіші қателерді түсінуге мүмкіндік беретін әдеттен тыс физикалық (немесе мінез-құлық) сипаттарды іздейді.

Генетиктің мұқият физикалық тексеруі көптеген құрылымдарды өлшеуді және дисморфиялық нәтижелерді бақылауды бағалауды қамтиды. Мүмкіндігінше өлшемдерді алу және стандартталған өсу диаграммаларымен салыстыру керек. сияқты сілтемелер Физикалық өлшемдер анықтамалығы 5 нақты өлшемдерді және ілеспе өсу диаграммаларын алуға болатын әдістердің сипаттамасын қамтиды.

Физикалық тексерудің сипаттамасы мен құжаттамасында нақты терминологияны пайдалану ұсынылады. Жаңартылған таңдаулы терминологияны https://elementsofmorphology.nih.gov/ «Морфология элементтері: адам ақауларының терминологиясы» жарияланған мақалалар жинағында табуға болады, олар бас сүйектер, қолдар терминдерінің дәл және анық анықтамаларын әзірлеуге арналған. , және аяқтар.

Генетиктер үшін бірінші «өмірлік белгілер» - ұзындықты, салмақты және бас шеңберін мұқият бағалауды қамтитын өсу параметрлері. Өсу немесе шамадан тыс өсу жаһандық ғана емес, аймақтық өсу айырмашылықтары да көптеген қатерлі ісік қаупімен байланысты. Макроцефалия көптеген генетикалық синдромдардың маңызды маркері болып табылады (мысалы PTEN-байланысты бұзылулар немесе невоидты базальды жасушалық карцинома синдромы) және микроцефалия көптеген хромосомалық делеция синдромдарында байқалады, олар қатерлі ісікке бейімділік гендері бар аймақтарға әсер етуі мүмкін.

Бағалау туа біткен немесе жүре пайда болған гиперпигментацияны немесе гипопигментацияны, өсінділерді (мысалы, липомалар) және телеангиэктазияларды бағалайтын толық тері тексеруін қамтуы керек. Пигментті өзгерістердің таралуын мұқият тексеру керек, өйткені жолақты гиперпигментация тіндік мозаизмнің белгісі болып табылады, бұл әдеттегі қан анализінде анықталмауы мүмкін генетикалық айырмашылықтарды көрсетеді. Шашты, тырнақты және тістерді тексерудің бір бөлігі ретінде мұқият тексеру керек және/немесе отбасылардан өсу үлгілері немесе олар байқаған кез келген бұзушылықтар туралы сұрау керек. Мысалы, жаңадан анықталған тоқ ішек қатерлі ісігі бар жасөспірімде ауыздың айналасындағы бірнеше қара дақтар маңызды емес болып көрінуі мүмкін, бірақ олар Пейц-Джегер синдромының диагнозын ұсынады.

Қалған зерттеуді бастан аяққа дейін, соның ішінде бет пен орбиталарды, құлақтарды, мұрынды, ауызды және жақты жүргізген дұрыс. Көзді тексеру периорбитальды белгілерді (көз аралығы, пальпебральды жарықшақтың көлемі және қиғаштығы) және көз құрылымдарын (мүмкіндігінше қарашықтар мен көз түбі) қамтуы керек. Симметрияны және әрбір аймақтың беттің жалпы көрінісіне қалай «сәйкес келетінін» бағалау үшін мұқият болу керек. Өлшемдер құрылымның объективті түрде үлкен немесе кіші екенін анықтауда өте пайдалы болуы мүмкін. Клиникалық генетиктер арасында кең таралған мақал – «алдымен оны өлшемей, оны үлкен немесе кішкентай деп айтпа», өйткені құрылым кішкентай немесе үлкен болып көрінуі мүмкін, бірақ басқа құрылымдарға пропорционалды емес.

Кеуде қуысы мен іш қуысын тексеру аускультацияны қамтуы керек, өйткені кейбір туа біткен жүрек ақаулары бұрын байқалмаған болуы мүмкін. (Жүрек аускультациясы - бұл бөлмедегі жас пациенттер тыныш және тыныш болатын уақыт, ал мұқият тексеруші бұл уақытты үнсіз түрде бетті егжей-тегжейлі бақылай алады.)

Несеп-жыныс мүшелерін тексеру сонымен қатар гипогонадизм белгілерін немесе тіпті тері жамылғысының жыныс мүшелерінің сепкілдері сияқты дерматологиялық өзгерістерді де анықтауы мүмкін. PTEN- байланысты бұзылулар.

Аяқтар мен тірек-қимыл аппаратын тексеру бас бармақтың жоқтығы немесе үш фалангальды болуы сияқты айқын ауытқуларды немесе кең сандар, клинодактилия немесе ассиметриялық алақан қыртыстары сияқты нәзік белгілерді анықтауы мүмкін. Аяқ-қолдардың асимметриясы гемигиперплазия болуы мүмкін, бұл жүйелік синдромды немесе тіндік мозаизмді көрсетуі мүмкін.

Толық неврологиялық тексеру сонымен қатар нәзік кемшіліктерді бағалаудың маңызды құралы болып табылады, дегенмен баланың алдыңғы бастапқы деңгейін және кез келген қатерлі ісікпен күресу немесе емдеу кезінде қандай тапшылықтар пайда болуы мүмкін екенін білу маңызды (мысалы, операциядан кейінгі өзгерістер).


ДНҚ полиморфизмдері: мәні мен класстары | Генетика

Бұл мақалада біз ДНҚ полиморфизмдерінің класстарының мағынасы туралы талқылаймыз.

ДНҚ полиморфизмінің мағынасы:

Геннің әртүрлі аллельдері екі немесе одан да көп гендердің әртүрлі аллельдері бар ата-аналар арасында крест жасау арқылы анықталуы мүмкін әртүрлі фенотиптерді тудырады. Содан кейін ұрпақтағы рекомбинанттарды анықтау арқылы генетикалық картаны шығаруға болады.

Бұл бақыланатын фенотиптік әсерлері бар гендерді қамтитын ажыратымдылығы төмен генетикалық карталар. Белгілі бір геннің немесе локустың орнын картадан табуға болады. Дегенмен, өлшеулер картаға түсірілген гендер арасындағы хромосомалық аралықтарда ДНҚ-ның көп мөлшері болатынын көрсетті.

Бұл аралықтарды рекомбинантты ұрпақ әдісімен салыстыру мүмкін болмады, себебі сол аралық аймақтарда маркерлер жоқ. Қосымша дифференциалды маркерлерді немесе бос орындарға түсетін генетикалық айырмашылықтарды табу қажет болды. Бұл қажеттілік әртүрлі полиморфты ДНҚ маркерлерін пайдалану арқылы қанағаттандырылды.

ДНҚ полиморфизмі - кез келген бақыланатын фенотиптік вариациямен байланысты емес ДНҚ тізбегінің вариациясы және міндетті түрде генде емес, геномның кез келген жерінде болуы мүмкін. Полиморфизм хромосомалық аймақтың екі немесе одан да көп альтернативті формаларының (аллельдердің) бірін білдіреді, не басқа нуклеотидтер тізбегі бар немесе онда тандемді қайталанатын нуклеотидтердің айнымалы саны бар.

Осылайша, ол кез келген дәйектілік вариациясы үшін гетерозиготалықтың орны болып табылады. Көптеген ДНҚ полиморфизмдері генетикалық картаны зерттеу үшін пайдалы, сондықтан олар ДНҚ маркерлері деп аталады. ДНҚ маркерлерін Southern blot гибридизациясында немесе ПТР арқылы анықтауға болады.

ДНҚ маркерлерінің аллельдері ко-доминантты, яғни олар көптеген гендердің аллельдерінде байқалатындай доминантты да, рецессивті де емес. ДНҚ полиморфизмдері жеке адамдар арасындағы молекулалық анықталған айырмашылықтарды құрайды.

ДНҚ полиморфизмдерінің кластары:

ДНҚ полиморфизмдерінің кейбір негізгі кластары бар.

1. Бір нуклеотидті полиморфизмдер:

SNP - бір базалық жұптың өзгеруі, нүктелік мутация және сайт SNP локусы деп аталады. SNP - ДНҚ полиморфизмінің ең көп таралған түрі, 350 негізгі жұптың бір жиілігімен кездеседі және ДНҚ тізбегінің вариациясының 90 пайызынан астамын құрайды. SNP көпшілігі геномның кодталмаған SNP деп аталатын кодталмаған аймақтарында бар екені анықталды. Кодтау аймақтарындағы, яғни гендердегі SNP кодтаушы SNP (cSNP) деп аталады.

Адамдардағы cSNP-терді егжей-тегжейлі зерттеулер әрбір генде шамамен төрт cSNP бар екенін көрсетеді, оның жартысы кодталған ақуызда қате мутацияға әкеледі, ал жартысы дыбыссыз мутацияларды тудырады. cSNP фенотипке әсер ете ме, полиморфизммен өзгеретін амин қышқылына байланысты.

SNP болып табылатын қате мутациялардың жартысы адамдарда генетикалық ауруды тудырады деп есептеледі. Кодталмаған SNP, егер ол промотор аймағында немесе генді реттейтін аймақта орналасса, ген функциясына да әсер етуі мүмкін. SNP аз саны шектеу сайтын жасай алады немесе бұрыннан бар шектеу сайтын жоя алады. Шектеу орындарындағы SNP-индукцияланған өзгерістер рестрикциялық ферментті, одан кейін Southern blot талдауын немесе ПТР көмегімен анықталады.

Жеке SNP локусын аллель-спецификалық олигонуклеотидті (ASO) гибридизациялау әдісі арқылы талдауға болады. Адамдарда белгілі бір SNP локусын іздеу қиынға соғады, өйткені бұл адам геномындағы үш миллиард базалық жұптың ішінде полиморфты болып табылатын бір базалық жұп.

ASO техникасында бір SNP аллельіне комплементарлы қысқа олигонуклеотид синтезделеді және мақсатты ДНҚ-мен араласады. Гибридизация зонд пен мақсатты ДНҚ арасындағы тамаша сәйкестікке ғана мүмкіндік беретін жоғары қатаң жағдайларда орындалады. Бұл дегеніміз, олигонуклеотид сол локуста кез келген басқа SNP аллелі бар мақсатты ДНҚ-мен будандаспайды. Гибридизацияның оң нәтижесі SNP локусын дәл көрсетеді.

Жүздеген немесе мыңдаған SNP-ді бір уақытта теру үшін ДНҚ микромассивтерінің ең жаңа әдісін қолдануға болады. SNP және геномдық кең ген экспрессиясы үшін қолданылатын бұл техниканың егжей-тегжейлері осы бөлімде кейінірек сипатталған.

SNP аз саны шектеу тораптарын жасау немесе біреуін жою арқылы шектеу тораптарындағы өзгерістерге әкелуі мүмкін. Мұндай SNP-терді сайт үшін шектеу ферментін пайдалану арқылы анықтауға болады, ал анықтау Southern blot талдауы немесе ПТР арқылы жүзеге асырылады. Әртүрлі геномдардағы шектеу орындарының әртүрлі үлгілері төменде сипатталған шектеу фрагментінің ұзындығы полиморфизмдері (RFLPs) деп аталатын әртүрлі ұзындықтағы фрагменттерді береді.

2. Шектеу фрагментінің ұзындығы полиморфизмдері:

RFLP - кейбір геномдарда бар және басқаларында жоқ шектеуші ферменттерді тану учаскелері. RFLP үшін гетерозиготалы ағзаны қарастырайық, оның генотипін біз Rr деп көрсетеміз. Бұл организм RFLP вариация аллелі (rr) үшін гомозиготалы басқа организммен кері байланысқан. Осы кресттің ұрпағынан алынған геномдық ДНҚ (Rr x rr ұрпақ береді, оның 50% Rr және 50% rr) рестрикциялық ферменттің қорытылуына ұшырайды, ал фрагменттері Southern blots бойынша бөлінеді.

Алынған шектеу фрагменттері RFLP үшін әртүрлі генотиптерді ажырататын зондпен (клондалған ДНҚ фрагменті) будандастырылған. Зонд ДНҚ бірегей, себебі ол геномның бір ғана ДНҚ сегментінен шыққан және шектеу аймағын қабаттасады. Сондықтан бұл әдістеменің негізгі нүктесі жеке маркер локусына тән арнайы клондалған бір көшірме ДНҚ зондын пайдалану болып табылады.

Оң RFLP организмінің басқа RFLP тудыратын организмдермен арасындағы кресттер ата-аналық комбинацияларды және қайта комбинацияларды береді. Рекомбинанттар жиілігінен егжей-тегжейлі RFLP картасын жасауға болады. RFLPs өсімдіктер мен жануарлар геномдарын сипаттау үшін қолданылған алғашқы ДНҚ маркерлері болды. Енді олар төменде сипатталған қысқа тандемді қайталаулар (STRs) санының өзгеруіне негізделген маркерлермен ауыстырылды.

3. Қысқа тандемді қайталау:

STR микросеріктері және қарапайым реттілік қайталануы (SSR) ретінде де белгілі. Тандемді қайталау – бір бағыттағы ұшынан соңына дейін қайталанатын тізбек. STR - бұл бірнеше рет қайталанатын 2-6 негіздік жұп ДНҚ тізбегі.

Мысалы, TCACATCACATCACATCACATCACA тізбегі TCACA тізбегінің бес есе қайталануы болып табылады. Адам геномында динуклеотидті, тринуклеотидті, төрт нуклеотидті, бес нуклеотидті және алты нуклеотидті СТР бар.

Микросателлиттік талдауды әрбір маркер локусына тән ПТР праймер жұбы ретінде қызмет ету үшін бір көшірме ДНҚ арқылы жасауға болады. Популяцияда бір немесе екі аллельі бар RFLP-ден айырмашылығы, STR-де популяциялық талдауда анықталуы мүмкін аллельдердің әлдеқайда көп саны бар.

Демек, STR-де гетерозиготалардың жоғары үлесі бар, бұл оларды картаға түсіру үшін қолайлы етеді. STR-дегі полиморфизмдер популяцияларда жиі кездеседі, бұл оларды генетикалық карта жасауда құнды құрал етеді.

4. Айнымалы сандар тандемінің қайталануы:

VNTRs, сондай-ақ шағын жерсеріктік маркерлер деп аталады, қайталау блогы STR-ге қарағанда сәл үлкенірек, ұзындығы жетіден бірнеше ондаған негізгі жұпқа дейін. Адамдардағы VNTR локустары ұзындығы 15-тен 100-ге дейін нуклеотидтерден тұратын қайталанатын бірліктерді қамтитын 1-5 кило-негізді тізбектер болып табылады. VNTR локустары да полиморфизмді көрсетеді. ПТР-ны жарамсыз ететін VNTR қайталануларының ұзағырақ болуына байланысты, VNTR талдауы шектеу қорытуына және Southern Blotting-ге сүйенеді.

Бүкіл геномдық ДНҚ шектеу ферментімен кесіледі, ол VNTR локусының екі жағында да кесіледі, бірақ VNTR массивтерінде мақсатты учаскесі жоқ, содан кейін Southern Blotting. VNTR локусының белгілі бір қайталану тізбегіне қарсы VNTR спецификалық зонд геномдағы қайталану ретінің барлық орындарында байланысады, нәтижесінде әртүрлі өлшемді фрагменттердің үлкен саны пайда болады.

Тандем қайталануларының саны бір индивидтен екіншісіне өзгереді, сондықтан Southern blot бір индивид үшін фрагменттердің нақты ажыратылатын үлгісін береді. Бұл үлгілерді ДНҚ саусақ іздері деп те атайды. Бұл әдіс жеке тұлғаларды анықтауда және текті анықтауда пайдалы қолдануды табады.

5. Микросателлиттік маркерлер:

Микросателлиттік маркерлер деп аталатын тандемде қайталанатын ди-нуклеотидтердің айнымалы саны геномда дисперсті. Ең көп таралған түрі - CA және қосымша GT қайталаулары. Зондтар ПТР көмегімен жеке микросателлит қайталануларын қоршаған ДНҚ аймақтарын анықтауға арналған.

Процедура адам ДНҚ-сын мысалға ала отырып, төмендегідей түсіндіріледі. Адамның геномдық ДНҚ-сы Alu l сияқты фермент арқылы ас қорытуды шектеуге ұшырайды, бұл ұзындығы шамамен 400 негіз жұбы фрагменттерге әкеледі. Фрагменттер векторға клондалады және Southern Blotting жүргізіледі.

Құрамында CA/GT ди-нуклеотидтері бар геномдық кірістірулерді анықтау үшін осы ди-нуклеотидтерге тән зондтар пайдаланылады. Оң клондардың тізбегі анықталады, солардың негізінде арнайы тандемді қайталанатын микросеріктік тізбектердің жан-жағындағы бір көшірмелік ДНҚ тізбегімен будандастыратын ПТР праймерлер құрастырылады. ПТР күшейту осы праймер жұптары мен геномдық ДНҚ көмегімен жүзеге асырылады.

Осылайша, егер тандемдік қайталанатын микросателлит тізбегінің созылуында қандай да бір өлшем ауытқуы болса, ол әртүрлі адамдардан алынған ДНҚ-ның гельдік электрофорезі арқылы анықталады. Өлшемдік вариациялар әртүрлі адамдарда әр түрлі болуы мүмкін, барлық осы вариацияларды анықтауға болады.Өлшемнің өзгеруі басқа өлшемдегі күшейту өніміне әкеледі және маркер аллелін білдіреді.

6. Кездейсоқ күшейтілген полиморфты ДНҚ:

RAPD кездейсоқ ПТР күшейтуге негізделген. Процедура кездейсоқ түрде геномның бірнеше түрлі аймақтарын күшейтетін ПТР үшін праймерлерді кездейсоқ жобалау арқылы жүзеге асырылады. Мұндай праймер олардың жанында, праймердің меншікті тізбегінің инверттелген көшірмелері бар ДНҚ аймақтарын ғана күшейтуге әкеледі.

ПТР өнімдері күшейтілген ДНҚ-ның әртүрлі өлшемдерін білдіретін ДНҚ жолақтарынан тұрады. Күшейтілген ДНҚ фрагменттерінің жиынтығы кездейсоқ күшейтілген полиморфты ДНҚ (RAPD) деп аталады. Кейбір жолақтар жеке адам үшін бірегей болуы мүмкін және карта талдауында ДНҚ маркерлері ретінде қызмет ете алады.


МАТЕРИАЛДАР МЕН ТӘСІЛДЕР

Ашытқы штаммдары, плазмидтер және антиденелер

Ашытқы штамдары 1-кестеде келтірілген. pRS305-SIR2, құрамында интегралдаушы плазмида мырза2 өзінің туған промоутері арқылы пайдаланылды. Мутант SIR2 гендер де осы векторларға клондалған.SIR2 және мутант мырза2 ішінде pRS305-SIR2 кесу арқылы штаммдар жасалды LEU2 генAflII сайт және стандартты ашытқы трансформация хаттамалары арқылы біріктірілген. SIR2 немесе мутант мырза2pET28a векторына клондалған рекомбинантты ақуызды өндіру үшін пайдаланылды. Гемагглютининнің (ГА) таңбалануы SIR4pSF323-SIR4–3XHA векторымен (Стив Белл сыйлығы) жасалды, ол тегтелген нұсқасын біріктіреді. SIR4 туған жерге SIR4 локус. Sir2p және Sir3p-ге қоян антиденесі бұрын сипатталған (Миллс т.б., 1999 Имайт.б., 2000). HA эпитопына 12CA5 антиденесі Кованс, ал ацетилденген H3 гистоны мен ацетилденген H4 гистоны Upstate Biotechnology (Lake Placid, NY) компаниясынан алынды.

Сайтқа бағытталған мутагенез SIR2

Сайтқа бағытталған мутанттар Imai бойынша pRS305-SIR2 ішінде жасалдыт.б. (2000) және pET-28a-ға қосалқы клондалған (Imai т.б., 2000). Мутациялар мутагенездің сәтті болуын қамтамасыз ету үшін реттелген. Ашытқыдағы Sir2p экспрессиясы анти-Sir2p антиденелерімен зерттелген тұтас жасуша сығындыларының Western blot талдауы арқылы бақыланды.

Рекомбинантты ақуызды және ферментативті талдауларды тазарту

Алты оның тегтелген рекомбинантты Sir2p және мутант Sir2p жоғарыда сипатталғандай pET28a плазмидасында генді шамадан тыс экспрессиялаған BL21 бактерияларынан тазартылды (Imai т.б., 2000). Гистондардың АДФ-рибозилденуі бұрын сипатталғандай анықталды (Имай т.б., 2000). Гистон деацетилдену белсенділігі Upstate Biotechnology компаниясының гистон деацетилаза талдау жинағын пайдалану арқылы тритиацияланған ацетатпен таңбаланған H4 гистонының N-терминал құйрығына (SGRGKGGKGLGKGGAKRHRC) сәйкес пептид арқылы өлшенді. Талдау 2 мкг рекомбинантты ақуызды таңбаланған пептидпен 1 ​​мМ NAD + түні бойы инкубациялау арқылы орындалды. Содан кейін этилацетат реакция нәтижесінде босатылған ацетил топтарын әлі де пептидпен байланысқан топтардан бөлу үшін пайдаланылды. Содан кейін деацитляция белсенділігі сцинтилляциялық есептегіштегі бос тритиацияланған ацетатты санау арқылы өлшенді. Гистонды деацетилдену талдаулары сонымен бірге реакцияны 1 сағат бойы орындау және реакция өнімдерін жоғарыда сипатталғандай жоғары өнімді сұйық хроматографияда (HPLC) жүргізу арқылы өлшенді (Imai). т.б., 2000).

Дыбыссыздандыру және рДНҚ рекомбинациясының талдаулары

Теломерлердегі дыбысты өшіруді тексеру үшін W303RT туындыларының 10 еселік сұйылтулары 5-фтороротикалық қышқылы (5-FOA) бар ортада анықталды. HM дыбысын өшіруді талдау үшін W303R туындылары CKy20 сынаушы штаммымен YPD-ге патчталған және бір түнде өскеннен кейін қосымша амин қышқылдары жоқ минималды ортаға көшірмемен қапталған. rDNA рекомбинациясының жылдамдығы Каберлейндегідей өлшенді т.б.(1999).

HA-Sir4 және Sir2 иммунопреципитациясы

Толық жасуша сығындылары 100 мл YPD-де өсірілген жасушалардан OD 1,0 (Strahl-Bolsinger) дейін дайындалды. т.б., 1997). Экстракт (200 мкл) лизис буферімен 500 мкл дейін сұйылтылды, оған 3 мкл анти-HA антиденесі қосылды және түні бойы 4°C температурада инкубацияланды. Содан кейін А протеинінің түйіршіктері қосылды және одан әрі 4°C температурада 1 сағат бойы инкубацияланды. Моншақтар лизис буферімен үш рет жуылды, содан кейін 60 мкл SDS жұмыс істейтін буферде қайнатылды. Western blotting талдауы үшін 7,5% PAGE гелінде он микролитр жүргізілді.

Хроматиндік иммунопреципитация

Ашытқы 100 мл YPD және OD 1,0 өсірілді. Айқас байланысқан сығындының иммунопреципитациясы негізінен сипатталғандай орындалды (Strahl-Bolsinger т.б., 1997), 2,5 мкл анти-SIR3 поликлоналды антидене немесе 5,0 мкл анти-SIR2 поликлоналды, антиацетилденген гистон H3 антидене немесе антиацитилденген гистон H4 антидене пайдалану арқылы. Иммунопреципитацияланған ДНҚ-ның полимеразды тізбекті реакциясының (ПТР) талдауы жалпы иммунопреципитацияланған ДНҚ-ның 1:25, 1:75 және 1:225 мөлшерін пайдалану арқылы 50 мкл реакция көлемдерінде орындалды. мынадай праймерлердің көмегімен сипатталған ПТР реакция жағдайлары болды: TEL-300.fwd, GGATATGTCAAAATTGGATACGCTTATG TEL-300.rev, CTATAGTTGATTATAGATCCTCAATGATC TEL-3000.fwd, TGATTCTGCTTTATCTACTTGCGTTTC TEL-3000.rev, AGAGTAACCATAGCTATTTACAATAGG XV-internal2.fwd, GTAGTTCGTTAGGTATGGACATTGATTTGGCC және XV-internal2 .rev, AAATGAA-ATGTATTGGGGCCTAGGTTCGCA. Slot blot талдауы 10 мкл иммунопреципитацияланған (IP) ДНҚ немесе 5 мкл кіріс ДНҚ aBio-Rad ұяшықтарды блоктау аппаратын пайдалану арқылы Zeta-Probe мембранасына сүрту арқылы орындалды. Содан кейін дақ 5S rDNA тізбегіне сәйкес келетін 32 P-таңбаланған ДНҚ фрагменті арқылы зерттелді.


Жиілікке тәуелді таңдау

2-сурет. Сары жұлдыру бүйірлік дақтары бар кесіртке көк тамақты немесе қызғылт сары жұлдыру еркектерінен кішірек және түрдің аналықтарына ұқсайды, бұл оның жұптасуға мүмкіндік береді. (Несие: «minifroglet»/Flickr)

Таңдаудың басқа түрі деп аталады жиілікке байланысты таңдау, жиі кездесетін (оң жиілікке тәуелді таңдау) немесе сирек (теріс жиілікке тәуелді таңдау) фенотиптерді қолдайды. Таңдаудың бұл түрінің қызықты мысалы Тынық мұхитының солтүстік-батысындағы кесірткелердің бірегей тобында көрінеді. Кәдімгі бүйірлік кесірткелер үш жұлдыру түсті үлгіде келеді: қызғылт сары, көк және сары. Бұл формалардың әрқайсысының репродуктивті стратегиясы әртүрлі: қызғылт сары аталықтары ең күшті және аналықтарына қол жеткізу үшін басқа еркектермен күресе алады Көк еркектер орташа өлшемді және жұбайларымен күшті жұптық байланыстарды құрайды (2-сурет) - ең кішкентай, және аналықтарға ұқсайды, бұл оларға жұптарды жасыруға мүмкіндік береді. Тас-қағаз-қайшы ойынындай қызғылт сары көкті, көк сарыды, сары түс қызғылт сарыны ұрғашылар сайысында ұрады. Яғни, үлкен, күшті қызғылт сары еркектер көк еркектермен жұптасу үшін көгілдір еркектермен күресе алады, көк еркектер өздерінің жұптарын сары кроссовкалардың еркектерінен қорғай алады, ал сары еркектер жұптарды жасыра алады. ірі, көп әйелді қызғылт сары еркектердің әлеуетті жұптары.

Бұл сценарийде популяцияда көгілдір еркектер басым болған кезде қызғылт сары еркектерге табиғи сұрыптау ұнайды, популяция негізінен сары аталық болған кезде көк еркектер өркендейді, ал сарғыш еркектер ең көп қоныстанған кезде сары еркектер таңдалады. Нәтижесінде, бүйірлік дақтары бар кесірткелердің популяциялары осы фенотиптердің таралуы бойынша айналым жасайды - бір ұрпақта апельсин басым болуы мүмкін, содан кейін сары аталықтардың жиілігі жоғарылай бастайды. Сары еркектер популяцияның көпшілігін құраса, көк еркектер таңдалады. Ақырында, көгілдір еркектер кең таралған кезде, қызғылт сары еркектер тағы да ұнайды.

Теріс жиілікке тәуелді таңдау сирек кездесетін фенотиптерді таңдау арқылы популяцияның генетикалық дисперсиясын арттыруға қызмет етеді, ал оң жиілікке тәуелді таңдау әдетте жалпы фенотиптерді таңдау арқылы генетикалық дисперсияны азайтады.


5. Агар пластиналарында РНҚ қоректенуі

Джули Ахрингер, Гурдон институты, Кембридж университеті, Кембридж CB2 1QN, Ұлыбритания

Қысқаша мазмұны: RNAi бактериялары мен тұқым тақталарын өсіріңіз. Құрттарды RNAi бактерияларымен қоректендіріңіз және фенотиптерге баға беріңіз. Төмендегілер Камат және басқалардағы хаттамаға негізделген. (2001).

5.1. Тамақтану табақтарын дайындау

Пластиналарды құйыңыз: стандартты NGM агарын жасаңыз және құю алдында 25 μ г/мл-ге карбенициллин және 1 мм-ге IPTG қосыңыз. Тұқым себуден 4𔃅 күн бұрын, олардың кебуіне мүмкіндік беру үшін табақтарды құйыңыз. Пластиналар тым дымқыл болса, сепкеннен кейін бактериялар құрғамайды және RNAi фенотиптері әлсіз болады. Азықтандыру кез келген форматты тақталарды (мысалы, жалғыз пластиналар, 6-ұңғы, 12-ұңғы) арқылы жүргізуге болады.

Глицерин қорынан 50 μ г/мл ампициллин (немесе 25 μ г/мл карбенициллин) және 10 μ г/мл тетрациклин бар LB пластинасына дейін жеке қалаған бактерия штамм(дар)ын табыңыз. 96 шұңқырлы пішімде өсетін болса, төртбұрышты жалпақ пластинадағы нүктені анықтау үшін 96 істікшелі репликаторды пайдаланыңыз. 37°C температурада түнде өсіңіз.

Құрамында 50 μг/мл ампициллин бар LB ортада дақылдарды өсіріңіз. 96 шұңқырлы пішім пайдаланылса, 96 шұңқырлы терең ұңғыма тақтасының әрбір ұңғымасына 800 μl орта қосыңыз. Дақылдарды егу үшін жолдан немесе бағаннан бактерияларды қырып алу және ұштарды ортаның дұрыс жолына немесе бағанына шығару үшін көп арналы тамшуырдағы жеке сары ұштарды немесе ұштарды пайдаланыңыз. Егуді аяқтағаннан кейін, ұштарды алыңыз және пластиналарды микротитрлі пластик қақпақтармен жабыңыз. 300 айн/мин 6𔃆 сағат бойы шайқау арқылы дақылдарды өсіріңіз.

Тұқымдық NGM агары бактерия культурасын қоректендіреді. 12 шұңқырлы тақталарды пайдалансаңыз, екі 30 μл тамшысын және 6 шұңқырлы немесе жеке тақталарды пайдалансаңыз, үш 50 μл тамшысын пайдаланыңыз. Кептіріңіз және бөлме температурасында түні бойы индукциялаңыз.

5.2. Құрттарды дайындау

OP50 бактериялары себілген стандартты NGM пластиналарында қалаған құрт штаммдарын өсіріңіз. Эмбриондарды алу үшін стандартты ағарту/жуу протоколын орындаңыз және түні бойы M9 буферінде L1-ге шығу үшін қалдырыңыз. Бұл аштық L1s L1 кезеңінің басында синхрондалады. Азықтандыру L1-ден асқан дернәсілдермен жасалатын болса, онда шыққан L1-ді OP50 бар стандартты NGM пластинкаларына салып, қажетті кезеңге дейін өсіріңіз.

M9 буферін пайдаланып тақталардан құрттарды жуыңыз, содан кейін бактерияларды жою үшін 3X жуыңыз. OP50 жою өте маңызды, өйткені қалдық RNAi емес бактериялар азықтандыру нәтижелеріне кедергі жасайды. Құрамында 0,1% Tween-20 бар M9 буферіндегі соңғы құрт түйіршіктерін пластмассаға жабыспау үшін қайта суспензиялаңыз. Буфердің көлемін бір табаққа алғыңыз келетін құрттар саны 10󈝻 μl болатындай етіп реттеңіз.

5.3. Тамақтандыру және ұпай жинау

Протоколдың бұл бөлігі талдауыңызға байланысты аздап ерекшеленеді. Тамақтандырғаннан кейін аликотацияланған құрттарды немесе олардың ұрпақтарын бағалауға болады. Кейбір талдаулар үшін ұрпақ синхрондалған болса, балл қою оңайырақ. Бұл жағдайда тамақтандырылған жүкті аналарға жұмыртқаны жаңа пластинаға салуға рұқсат етіледі, содан кейін оларды алып тастайды, ал ұрпақ кейіннен ұпай алады. Бұл қадам көп уақытты қажет етеді және әрқашан қажет емес.

5.3.1. Стандартты L3/L4 азықтандыру протоколы: синхрондалған ұрпақты бағалау

Бұл хаттамада 24 сағаттық терезеде қойылған ұрпақтың жартылай синхрондалған популяциясы бағаланады.

Бір пластинкаға немесе ұңғымаға 10󈝻 μл L3/L4 құрттары (10󈞀 құрттар) аликвоты.

RNAi күшіне енуі үшін 15°C температурада 72 сағат қалдырыңыз (немесе 22°C температурада 36 821140 сағат), содан кейін жалғыз ересектерді басқа пластиналарға немесе бірдей бактериялар себілген ұңғымаларға көшіріңіз.

24 сағаттан кейін репликадан ересектерді алып тастаңыз және тиісті уақыт нүктелерінде ұрпақты фенотиптерге бағалаңыз.

5.3.2. Жеңілдетілген L3/L4 азықтандыру протоколы: асинхронды ұрпақты бағалау

Бұл хаттамада емізетін аналардың барлық ұрпақтары баллмен бағаланады. Оның жылдам болуының артықшылығы бар, өйткені репликамен қаптау жоқ. Азықтандыру протоколында ерте және кеш қойылған ұрпақтар бір ұңғымада болады, олар әлсізден күштіге дейін RNAi тітіркендіреді. Бұл постэмбриональды фенотиптерге скрининг кезінде пайдалы болуы мүмкін, мұнда күшті нокдаун эмбриональды өлімге әкелуі мүмкін. Төмен пайыздық эмбриональды өлімді бұл әдісті қолдану арқылы бағалау қиын.

Бір пластинаға немесе ұңғымаға L3/L4 құрттарының 10󈝻 μл. Ересектер мен барлық ұрпақтар осы бастапқы тәрелкеде немесе құдықта қалатындықтан, қол жетімді тағам үшін тым көп құрт болмауы маңызды. Оңтайлы сан эмпирикалық жолмен анықталуы керек. 6 шұңқырлы пластиналар үшін әр шұңқырға 10 құртты пайдалану көп жағдайда ересек ұрпақты бағалауға мүмкіндік береді.

Ұрпақ қалаған жасқа жеткенде ұпай жинаңыз.

5.3.3. L4s орнына L1s беру

Жоғарыда көрсетілген хаттамалардың кез келгенінде L4 орнына L1s пайдалануға болады. L1s қолданудың артықшылығы - кейбір фенотиптерді ұрпақтың орнына қоректенетін құрттарда анықтауға болады, бұл оңай ұпайланған синхрондалған популяцияны пайдалануға мүмкіндік береді. Алайда кейбір гендер үшін тұқым қуалайтын аналық өнім гендік белсенділік үшін жеткілікті болады, қоректенетін құрттарда фенотиптің индукциясын болдырмайды. Сондай-ақ, көптеген гендер дамуда бірнеше рет қажет болғандықтан, L4-мен салыстырғанда L1-ді пайдаланған кезде әртүрлі фенотиптерді көруге болады. Мысалы, кейбір гендердің RNAi қоректенетін L1-нің стерильділігін индукциялайды, ал L4 қоректенуі ұрпақтың эмбриональды өлімін тудырады. Бұл L1-лер қоректендірілсе, бұл гендер үшін ұрпақты бағалауды болдырмайды. Керісінше, L1s пайдалану, егер талдау өлімнің кез келген түріне (мысалы, бедеулік, дернәсілдік өлім немесе эмбриональды өлім) қатысты болса, тиімді.

Ескертпелер: Ағартылған эмбриондарды алдымен аш L1 эмбриондарына шығарудың орнына тікелей азықтандыру пластиналарына бөлу ұсынылмайды, себебі эмбриондар бір-біріне жабысатындықтан, бірдей жануарлар/құдық санын бөлу қиынырақ. Сондай-ақ, ағартылған препараттар арасындағы ауыспалы инкубациялық жылдамдықтар тәжірибе аралық вариацияны тудырады.

5.4. Екі бактерия штамдарын бір уақытта тамақтандыру

Протокол бір бактериялық штаммды азықтандыруға ұқсас, тек екі бактерия культурасы себу алдында араласады. Қосарланған азықтандыру RNAi аса сезімтал штаммында әлдеқайда жақсы және қайталанатын жұмыс істейді (мысалы, rrf-3 Симер және т.б., 2002 ж eri-1 Кеннеди және т.б., 2004 немесе eri-1 lin-15B Ван және т.б., 2005 С. Вудс, Д. Риверс және Дж. Ахрингер, жарияланбаған А. Фрейзер, перс. коммуникация). 17 бақылау қосарланған азықтандыру сынақтарында 4-уі сәтті болды eri-1 , 7 дюйм rrf-3 , және 14 дюйм eri-1 lin-15B (С. Вудс, Д. Риверс және Дж. Ахрингер, жарияланбаған). Қосарланған азықтандыру бір реттік азықтандыруға қарағанда сенімді емес, сондықтан кейбір жағдайларда тек бір ген айтарлықтай тежелуі мүмкін немесе екі ген де аздап ыдырайды. Әрбір геннің нокдаунына сынау үшін бақылау жүргізу керек.

5.5. Алғыс

Зертхана мүшелеріне пікірлері үшін алғыс айтамын. Бұл Джино Поулин, Дэвид Риверс және Шейн Вудс модификациялары бар Рави Камат (Kamath және т.б., 2001) әзірлеген хаттаманың модификациясы.


Сілтемелер

† Ағымдағы мекенжайы: Сиань Цзяотонг-Ливерпуль университетінің биологиялық ғылымдар бөлімі, 111 Ренъай жолы, Сучжоу 215123, Қытай Халық Республикасы

Электрондық қосымша материалды https://doi.org/10.6084/m9.figshare.c.4933104 сайтынан алуға болады.

Түпнұсқа авторы мен дереккөзі көрсетілген жағдайда, шектеусіз пайдалануға рұқсат беретін Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/ шарттары бойынша Корольдік қоғам шығарған.

Анықтамалар

. 2011 Неліктен біз қатерлі ісікпен ауырмаймыз? Қатерлі ісіктің дамуын тежеудегі микроортаның ұсынылатын рөлі. Нат. Мед. 17, 320-329. (doi:10.1038/nm.2328) Crossref, PubMed, ISI, Google Scholar

Фридман В.Х., Зитвогель Л, Саутс-Фридман С, Кроемер Г

. 2017 Қатерлі ісіктерді болжау және емдеудегі иммундық контекст. Нат. Rev. Clin. Онкол. 14, 717. (doi:10.1038/nrclinonc.2017.101) Crossref, PubMed, ISI, Google Scholar

Вермеулен Л, Моррисси Е, ван дер Хейден М, Николсон А.М., Сотторива А, Бучаки С, Кемп Р, Таваре С, Уинтон диджейлері

. 2013 Ішек ісіктерінің басталу үлгілеріндегі дің жасушаларының динамикасын анықтау. Ғылым 342, 995-998. (doi:10.1126/science.1243148) Crossref, PubMed, ISI, Google Scholar

. 1889 Сүт безінің қатерлі ісігіндегі қайталама өсінділердің таралуы . Лансет 133, 571-573. (doi:10.1016/S0140-6736(00)49915-0) Кроссреф, Google ғалымы

. 1976 Ісік жасушаларының популяцияларының клональды эволюциясы. Ғылым 194, 23-28. (doi:10.1126/science.959840) Crossref, PubMed, ISI, Google Scholar

. 1993 Мутациялар, эволюциялық теория және қатерлі ісік. Trends Ecol. Эволюция. 8, 107-110. (doi:10.1016/0169-5347(93)90062-T) Crossref, PubMed, ISI, Google Scholar

. 2001 Ісік-хост интерфейсінің микроортасы. Табиғат 411, 375-379. (doi:10.1038/35077241) Crossref, PubMed, ISI, Google Scholar

Merlo LM, Pepper JW, Reid BJ, Maley CC

. 2006 Қатерлі ісік эволюциялық және экологиялық процесс ретінде. Нат. Қатерлі ісік 6, 924-935. (doi:10.1038/nrc2013) Crossref, PubMed, ISI, Google Scholar

Королев К.С., Ксавье Дж.Б., Гор Дж

. 2014 Экология мен эволюцияны қатерлі ісікке қарсы айналдыру. Нат. Қатерлі ісік 14, 371-380. (doi:10.1038/nrc3712) Crossref, PubMed, ISI, Google Scholar

. 2005 Қатерлі ісіктің эволюциялық биологиясы. Trends Ecol. Эвол. 20, 545-552. (doi:10.1016/j.tree.2005.07.007) Crossref, PubMed, ISI, Google Scholar

. 1993 Қатерлі ісіктің көп сатылы сипаты. Трендтер Genet. 9, 138-141. (doi:10.1016/0168-9525(93)90209-Z) Crossref, PubMed, ISI, Google Scholar

. 2005 Бейімделудің генетикалық теориясы: қысқаша тарих. Нат. Аян Генет. 6, 119-127. (doi:10.1038/nrg1523) Crossref, PubMed, ISI, Google Scholar

. 2008 Канцерогенездің микроорталық моделі. Нат. Қатерлі ісік 8, 56-61. (doi:10.1038/nrc2255) Crossref, PubMed, ISI, Google Scholar

Джунттила MR, де Сауваж ФДж

. 2013 Ісік микроортасының гетерогенділігінің терапевтік жауапқа әсері. Табиғат 501, 346-354. (doi:10.1038/nature12626) Crossref, PubMed, ISI, Google Scholar

. 2013 Ісік прогрессиясы мен метастаздың микроорталық реттелуі. Нат. Мед. 19, 1423-1437. (doi:10.1038/nm.3394) Crossref, PubMed, ISI, Google Scholar

. 2016 Жетілдірілген колоректальды қатерлі ісік кезіндегі микроортаға бағытталған. Трендтер Қатерлі ісік 2, 495-504. (doi:10.1016/j.trecan.2016.08.001) Crossref, PubMed, ISI, Google Scholar

2017 Аналық без обыры бар науқаста дифференциалды түрде өсіп келе жатқан метастаздар арасындағы гетерогенді ісік-иммундық микроорталар. Ұяшық 170, 927-938.e20. (doi:10.1016/j.cell.2017.07.025) Crossref, PubMed, ISI, Google Scholar

2018 Аналық без обырындағы қатерлі және иммунологиялық клондық динамиканың интерфейстері. Ұяшық 173, 1755-1769.e22.(doi:10.1016/j.cell.2018.03.073) Crossref, PubMed, ISI, Google Scholar

. 2011 Қатерлі ісік белгілері: келесі ұрпақ. Ұяшық 144, 646-674. (doi:10.1016/j.cell.2011.02.013) Crossref, PubMed, ISI, Google Scholar

Лан С, Хайндл А, Хуан Х, Си С, Банерджи С, Лю Дж, Юань Ы

. 2015 Аналық без ісіктерінің микроортасының сандық гистологиялық талдауы. Ғылым. Реп. 5, 16317. (doi:10.1038/srep16317) Crossref, PubMed, ISI, Google Scholar

2015 Экзосомалық микроРНҚ арқылы микроорта тудырған PTEN жоғалуы мидың метастазының өсуіне ықпал етеді. Табиғат 527, 100-104. (doi:10.1038/nature15376) Crossref, PubMed, ISI, Google Scholar

2016 Т-жасушалық жедел лейкоз сүйек кемігінің микроорталарымен динамикалық өзара әрекеттесуін көрсетеді. Табиғат 538, 518-522. (doi:10.1038/nature19801) Crossref, PubMed, ISI, Google Scholar

. 2016 Метастазға дейінгі тауашаның сипаттамасы мен маңызы. Қатерлі ісік жасушасы 30, 668-681. (doi:10.1016/j.ccell.2016.09.011) Crossref, PubMed, ISI, Google Scholar

Dewhirst MW, Cao Y, Moeller B

. 2008 Циклдік гипоксия және бос радикалдар ангиогенезді және сәулелік терапия реакциясын реттейді. Нат. Қатерлі ісік 8, 425-437. (doi:10.1038/nrc2397) Crossref, PubMed, ISI, Google Scholar

. 2016 Метастазды гипоксиялық бақылау. Ғылым 352, 175-180. (doi:10.1126/science.aaf4405) Crossref, PubMed, ISI, Google Scholar

Альтрок PM, Лю Л.Л., Михор Ф

. 2015 Қатерлі ісік математикасы: сандық модельдерді біріктіру. Нат. Қатерлі ісік 15, 730-745. (doi:10.1038/nrc4029) Crossref, PubMed, ISI, Google Scholar

. 1997 Ісік жасушалары арасындағы өзара әрекеттесу салдарын модельдеу. Бр. J. Қатерлі ісік 75, 157-160. (doi:10.1038/bjc.1997.26) Crossref, PubMed, ISI, Google Scholar

Ваклав Б, Бозич И, Питтман М.Е., Хрубан Р.Х., Фогельштейн Б, Новак М.А.

. 2015 Кеңістіктік модель дисперсті және жасуша айналымы ісік ішілік гетерогенділікті шектейтінін болжайды. Табиғат 525, 261-264. (doi:10.1038/nature14971) Crossref, PubMed, ISI, Google Scholar

2015 Адамның колоректальды ісік өсуінің Үлкен жарылыс үлгісі. Нат. Генет. 47, 209-216. (doi:10.1038/ng.3214) Crossref, PubMed, ISI, Google Scholar

Андерсон А.Р., Уивер А.М., Каммингс ПТ, Кваранта В

. 2006 Ісік морфологиясы және фенотиптік эволюция микроортадан селективті қысымға негізделген. Ұяшық 127, 905-915. (doi:10.1016/j.cell.2006.09.042) Crossref, PubMed, ISI, Google Scholar

Lloyd MC, Cunningham JJ, Bui MM, Gillies RJ, Brown JS, Gatenby RA

. 2016 Ісікішілік гетерогендіктің дарвиндік динамикасы: кездейсоқ мутациялар ғана емес, сонымен қатар өзгермелі қоршаған ортаны таңдау күштері. Рак рес. 76, 3136-3144. (doi:10.1158/0008-5472.CAN-15-2962) Crossref, PubMed, ISI, Google Scholar

. 1930 Табиғи сұрыпталудың генетикалық теориясы . Оксфорд, Ұлыбритания: Clarendon Press. Кроссреф, Google ғалымы

. 2005 Фишер микроскопы және Халден эллипсі. Ам. Нат. 166, 447-457. (doi:10.1086/444404) Crossref, PubMed, ISI, Google Scholar

2015 Аберрантты эпителий GREM1 экспрессиясы дің жасушаларының ұясынан тыс жасушалардан тоқ ішек ісіктерін бастайды. Нат. Мед. 21, 62-70. (doi:10.1038/nm.3750) Crossref, PubMed, ISI, Google Scholar

Кастро-Джинер Ф, Рэтклифф П, Томлинсон И

. 2015 Полигендік қатерлі ісік эволюциясының шағын драйвер моделі. Нат. Қатерлі ісік 15, 680-685. (doi:10.1038/nrc3999) Crossref, PubMed, ISI, Google Scholar

Barnett GC, West CM, Dunning AM, Elliott RM, Coles CE, Pharoah PD, Burnet NG

. 2009 Сәулелік терапияға қалыпты тіндік реакциялар: генотип бойынша емдеу дозасын бейімдеу үшін. Нат. Қатерлі ісік 9, 134-142. (doi:10.1038/nrc2587) Crossref, PubMed, ISI, Google Scholar

Темко Д, Томлинсон IPM, Северини С, Шустер-Боклер Б, Грэм Т.А.

. 2018 Мутациялық процестер мен таңдаудың қатерлі ісік түрлері бойынша драйвер мутацияларына әсері. Нат. Коммун. 9, 1857. (doi:10.1038/s41467-018-04208-6) Crossref, PubMed, ISI, Google Scholar

. 2013 Қартаю процестері қатерлі ісікке қалай әсер етеді. Нат. Қатерлі ісік 13, 357-365. (doi:10.1038/nrc3497) Crossref, PubMed, ISI, Google Scholar

Ривз MQ, Kandyba E, Harris S, Del Rosario R, Balmain A

. 2018 Көп түсті линияларды анықтау сквамозды карцинома эволюциясының басталуынан метастазға дейінгі клондық динамикасын көрсетеді. Нат. Биол жасушасы. 20, 699-709. (doi:10.1038/s41556-018-0109-0) Crossref, PubMed, ISI, Google Scholar

. 2019 Кеңістіктік желілердің критикалық мінез-құлқы ісіктегі паракриндік сигнализация үлгісі ретінде. Қолданба. Желі. Ғылым. 4, 47. (doi:10.1007/s41109-019-0167-7) Crossref, Google Scholar

. 2001 Күрделі желілердегі Бозе-Эйнштейн конденсациясы. Физ. Рев. Летт. 86, 5632-5635. (doi:10.1103/PhysRevLett.86.5632) Crossref, PubMed, ISI, Google Scholar

. 1963 Сүтқоректілердің жасушаларындағы өмірлік циклді талдау. Табиғат 198, 359-361. (doi:10.1038/198359a0) Crossref, ISI, Google Scholar

. 2019 Циркадиандық сағаттар және қатерлі ісік: уақытты сақтау жасушалық метаболизмді басқарады. Трендтер Эндокринол. Метаб. 30, 445-458. (doi:10.1016/j.tem.2019.05.001) Crossref, PubMed, ISI, Google Scholar

. 2019 Циркадиандық сағат пен қатерлі ісік арасындағы өзара әрекеттесу: қатерлі ісік ауруын емдеудің жаңа шекаралары. Трендтер Қатерлі ісік 5, 475-494. (doi:10.1016/j.trecan.2019.07.002) Crossref, PubMed, ISI, Google Scholar

Gatenby RA, Silva AS, Gillies RJ, Frieden BR

. 2004 Метрномиялық химиотерапияның антиангиогендік негізі. Нат. Қатерлі ісік 4, 423-436. (doi:10.1038/nrc1369) Crossref, PubMed, ISI, Google Scholar

Чжан Дж., Каннингэм Дж.Дж., Браун Дж.С., Гатенби Р.А

. 2017 Эволюциялық динамиканы метастаздық кастритке төзімді простата обырын емдеуге біріктіру. Нат. Коммун. 8, 1816. (doi:10.1038/s41467-017-01968-5) Crossref, PubMed, ISI, Google Scholar

. 2005 Ісік микроортасының емдік мақсаттылығы. Қатерлі ісік жасушасы 7, 513-520. (doi:10.1016/j.ccr.2005.05.024) Crossref, PubMed, ISI, Google Scholar

Пич О, Муинос Ф, Лолкема МП, Стигз Н, Гонсалес-Перес А, Лопес-Бигас Н.

. 2019 Қатерлі ісік терапиясының мутациялық іздері. Нат. Генет. 51, 1732-1740. (doi:10.1038/s41588-019-0525-5) Crossref, PubMed, ISI, Google Scholar

Уильямс МЖ, Вернер Б, Хайде Т, Кертис С, Барнс CP, Сотторива А, Грэм Т.А.

. 2018 Жаппай секвенирлеу деректерінен қатерлі ісіктегі субклональды таңдаудың сандық көрсеткіші. Нат. Генет. 50, 895-903. (doi:10.1038/s41588-018-0128-6) Crossref, PubMed, ISI, Google Scholar

. 2012 Дарвиндік оң таңдаусыз адаптивті фенотиптік белгілердің эволюциясы. Тұқым қуалаушылық 108, 347-353. (doi:10.1038/hdy.2011.97) Crossref, PubMed, ISI, Google Scholar

. 1932 Мутацияның, инбридингтің, будандастырудың және эволюциядағы селекцияның рөлі. Прок. Алтыншы Инт. Конгр. Генет. 1, 356-366. Google ғалымы

. 1932 Эволюцияның себептері , Нью-Йорк, Нью-Йорк: Longmans, Green and Co. Google ғалымы

. 2006 Фишердің геометриялық моделінің жалпы көп өзгермелі кеңеюі және түрлер бойынша мутация фитнес әсерлерінің таралуы. Эволюция 60, 893-907. (doi:10.1111/j.0014-3820.2006.tb01169.x) Crossref, PubMed, ISI, Google Scholar

Матушевский С, Гермиссон Дж, Копп М

. 2014 жылжымалы оңтайлы Фишердің геометриялық моделі. Эволюция. 68, 2571-2588. (doi:10.1111/evo.12465) Crossref, PubMed, ISI, Google Scholar

. 2014 Фишердің геометриялық моделінің эволюциялық генетикадағы пайдасы. Анну. Rev. Ecol. Эвол. Жүйе. 45, 179-201. (doi:10.1146/annurev-ecolsys-120213-091846) Crossref, PubMed, ISI, Google Scholar

Фрейс С, Гуннарссон П.А., Розе Д, Бирн Н, Уэлч Дж.

. 2016 Түрлену генетикасы: Фишердің геометриялық моделінен алынған түсініктер. Эволюция 70, 1450-1464. (doi:10.1111/evo.12968) Crossref, PubMed, ISI, Google Scholar

Лоуренко Дж.М., Глемин С, Галтиер Н

. 2013 өзгермелі ортада молекулалық бейімделу жылдамдығы. Мол. Биол. Эвол. 30, 1292-1301. (doi:10.1093/molbev/mst026) Crossref, PubMed, ISI, Google Scholar

Разето-Барри П, Диас Дж, Васкес Р.А

. 2012 Фишер геометриялық шеңбері бойынша молекулалық эволюцияның дерлік бейтарап және таңдау теориялары: алмастыру жылдамдығы, популяция мөлшері және күрделілік. Генетика 191, 523-534. (doi:10.1534/genetics.112.138628) Crossref, PubMed, ISI, Google Scholar

Бланкварт Ф, Ахаз Г, Батейлон Т, Тенаиллон О

. 2014 Фишердің геометриялық моделі бойынша таңдалған мутациялар мен генотиптік ландшафттардың қасиеттері. Эволюция 68, 3537-3554. (doi:10.1111/evo.12545) Crossref, PubMed, ISI, Google Scholar

. 1999 Селекция, мутация жылдамдығы және қатерлі ісік: құйрықтың итті шайқамауын қамтамасыз ету. Нат. Мед. 5, 11-12. (doi:10.1038/4687) Crossref, PubMed, ISI, Google Scholar

. 1999 Жыныс және өзгермелі ортадағы бейімделу. Генетика 153, 1041-1053. PubMed, ISI, Google Scholar

. 2009 Фенотиптік бейімделудің генетикалық негізі II: адаптивті алмастырулардың қозғалмалы оптималды модельде таралуы. Генетика 183, 1453-1476. (doi:10.1534/genetics.109.106195) Crossref, PubMed, ISI, Google Scholar

. 2012 Фишердің фитнес ландшафтының геометриялық моделі және өзгермелі ортадағы фитнестегі дисперсия. Эволюция 66, 2350-2368. (doi:10.1111/j.1558-5646.2012.01610.x) Crossref, PubMed, ISI, Google Scholar

. 2006 Фишердің эволюциялық бейімделудің геометриялық моделі - сфералық геометриядан тыс. J Теор. Биол. 241, 887-895. (doi:10.1016/j.jtbi.2006.01.024) Crossref, PubMed, ISI, Google Scholar

Сотторива А, Спитери I, Шибата Д, Кертис С, Таваре С

. 2013 Бір молекулалы геномдық деректер пациентке тән ісік профильдерін және қатерлі ісік жасушаларының құрылымын анықтайды. Рак рес. 73, 41-49. (doi:10.1158/0008-5472.CAN-12-2273) Crossref, PubMed, ISI, Google Scholar

Джонс А.Г., Арнольд СДж, Бургер Р

. 2004 жылжымалы оптимумы бар ландшафттағы G-матрицасының эволюциясы және тұрақтылығы. Эволюция 58, 1639-1654. (doi:10.1111/j.0014-3820.2004.tb00450.x) Crossref, PubMed, ISI, Google Scholar

. 1993 Бағытты таңдау және жыныс және рекомбинация эволюциясы. Генет. Res. 61, 205-224. (doi:10.1017/S0016672300031372) Crossref, PubMed, ISI, Google Scholar

Елена С.Ф., Купер В.С., Ленски Р.Е

. 1996 Сирек кездесетін пайдалы мутацияларды таңдаудан туындаған пунктуациялық эволюция. Ғылым 272, 1802-1804. (doi:10.1126/science.272.5269.1802) Crossref, PubMed, ISI, Google Scholar

2009 Байланысты тежеуге жоғары сезімталдық жалаңаш моль-егеуқұйрықтың қатерлі ісікке төзімділігіне анықтама береді. Прок. Натл Акад. Ғылым. АҚШ 106, 19 352-19 357. (doi:10.1073/pnas.0905252106) Crossref, ISI, Google Scholar

Сулак М, Фонг Л, Мика К, Чигурупати С, Йон Л, Монган НП, Эмес РД, Линч В.Дж.

. 2016 жылғы TP53 көшірме санының кеңеюі пілдердегі дене мөлшерінің ұлғаюымен және ДНҚ-ның зақымдалу реакциясының жоғарылауымен байланысты. eLife 5, e11994. (doi:10.7554/eLife.11994) Crossref, PubMed, ISI, Google Scholar

2010 Ісік прогрессиясы кезінде жүргізуші мен жолаушы мутацияларының жинақталуы. Прок. Натл Акад. Ғылым. АҚШ 107, 18 545-18 550. (doi:10.1073/pnas.1010978107) Crossref, ISI, Google Scholar

. 2009 Фенотиптік бейімделудің генетикалық негізі I: жылжымалы оңтайлы модельде пайдалы мутацияларды бекіту. Генетика 182, 233-249. (doi:10.1534/genetics.108.099820) Crossref, PubMed, ISI, Google Scholar

. 2015 Орталардағы мутациялардың фитнес әсері: бірнеше оптималды Фишердің геометриялық моделі. Эволюция 69, 1433-1447. (doi:10.1111/evo.12671) Crossref, PubMed, ISI, Google Scholar

2004 Патогендердің эпидемиологиялық және эволюциялық динамикасын біріктіру . Ғылым 303, 327-332. (doi:10.1126/science.1090727) Crossref, PubMed, ISI, Google Scholar

. 2005 Филогенетикалық ағаш теңгерімсіздігінің статистикалық сынақтары бойынша: Сакин және басқа индекстер қайта қаралды. Математика. Биология. 195, 141-153. (doi:10.1016/j.mbs.2005.03.003) Crossref, PubMed, ISI, Google Scholar

. 2015 Уақыт белгісі бар филогениялардағы асимметрияны өлшеу. PLoS есептеуі. Биол. 11, e1004312. (doi:10.1371/journal.pcbi.1004312) Crossref, PubMed, ISI, Google Scholar

Мартин Г, Елена С.Ф., Ленорманд Т

. 2007 Микробтардағы эпистаздың таралуы фитнес-ландшафт моделінің болжамдарына сәйкес келеді. Нат. Генет. 39, 555-560. (doi:10.1038/ng1998) Crossref, PubMed, ISI, Google Scholar

. 2010 Коллоквиум құжаттары: адаптивті ландшафттар және ақуыз эволюциясы. Проц. Натл Акад. Ғылым. АҚШ 107(1-қосымша), 1747-1751 жж. (doi:10.1073/pnas.0906192106) Crossref, PubMed, ISI, Google Scholar

Szendro IG, Schenk MF, Franke J, Krug J, de Visser JAGM

. 2013 Эмпирикалық фитнес пейзаждарының сандық талдаулары. Дж. Стат. Механ.: Теория Exp. 2013, P01005. (doi:10.1088/1742-5468/2013/01/P01005) Crossref, ISI, Google Scholar



Пікірлер:

  1. Tagar

    Sure, he's right

  2. Jum

    Hmm ... I was just thinking about this topic, but here such a post is gorgeous, thanks!

  3. Cenwalh

    Excuse for that I interfere... But this theme is very close to me. Премьер-Министрге жазыңыз.



Хабарлама жазыңыз